{ "project": { "name": "Efficient New Language", "short_name": "EML", "canonical_domain": "efficientnewlanguage.org", "maintainer": "Neo.K / EveMissLab", "license": "Apache-2.0", "patent": "Taiwan Utility Model M672933 (Taiwan only)", "repository": "https://github.com/kakon77777-commits/efficientnewlanguage", "status": "active-experimental", "spec": "EML-LANG-2026-v1.0", "eml_impl": "0.1.0", "ai_layer_version": "0.1.0", "updated": "2026-07-19" }, "purpose": { "summary": "Machine-readable corpus and bounded tool interface for EML — a deterministic semantic-overlay layer that compresses high-frequency program intent into symbols and transpiles, rule-based and reversibly, to Python.", "target_consumers": [ "LLM crawlers", "autonomous agents", "reasoning systems", "documentation agents", "future model ingestion pipelines", "programmatic clients" ] }, "entrypoints": { "human_home": "/", "playground": "/app", "docs": "/docs", "origins": "/origins", "related": "/related", "llms": "/llms.txt", "ai_index": "/ai/index.md", "manifest": "/ai/manifest.json", "version": "/ai/version.json", "projects": "/eml-p/projects/" }, "corpus": [ { "id": "eml-origin", "path": "/ai/corpus/eml-origin.md", "format": "markdown", "role": "conceptual genealogy" }, { "id": "eml-u-profile", "path": "/ai/corpus/eml-u-profile.md", "format": "markdown", "role": "EML-U (Universal Semantic Profile) — the original, broader vision, preserved as written; for the engineering today see eml-u-overview" }, { "id": "eml-u-overview", "path": "/ai/eml-u/overview.md", "format": "markdown", "role": "EML-U today (dated 2026-10-05): language evolution through semantic composition; the bounded experimental MVP, its limits and the corpus plan" }, { "id": "eml-u-engineering-snapshot", "path": "/ai/eml-u/engineering-snapshot.json", "format": "json", "role": "EML-U dated engineering snapshot (2026-10-05): counts, profiles, targets and explicit limits; a summary, not a raw execution receipt" }, { "id": "eml-p-eml-u-compatibility", "path": "/ai/corpus/eml-p-eml-u-compatibility.md", "format": "markdown", "role": "subset relation, projection function, and no-silent-loss rule between EML-P and EML-U" }, { "id": "eml-current", "path": "/ai/corpus/eml-current.md", "format": "markdown", "role": "current implementation explanation" }, { "id": "eml-design-history", "path": "/ai/corpus/eml-design-history.md", "format": "markdown", "role": "evolution from concept to implementation" }, { "id": "eml-engineering-notes", "path": "/ai/corpus/eml-engineering-notes.md", "format": "markdown", "role": "behavioral facts & invariants for generators" } ], "specs": [ { "id": "eml-v1", "path": "/ai/specs/eml-v1.md", "format": "markdown", "role": "v1.0 spec digest" }, { "id": "eml-semantic-model-v1.5", "path": "/ai/specs/eml-semantic-model-v1.5.md", "format": "markdown", "role": "self-contained AI-semantic spec: status vocabulary, twelve-loop taxonomy, bug/repair/criticality models" }, { "id": "eml-grammar", "path": "/ai/specs/eml-grammar.ebnf", "format": "ebnf", "role": "normative grammar" }, { "id": "eml-ast-schema", "path": "/ai/specs/eml-ast-schema.json", "format": "json-schema", "role": "AST schema" }, { "id": "eml-trace-schema", "path": "/ai/specs/eml-trace-schema.json", "format": "json-schema", "role": "eml-trace-v1 trace schema" }, { "id": "eml-error-schema", "path": "/ai/specs/eml-error-schema.json", "format": "json-schema", "role": "diagnostics & tool error schema" } ], "examples": [ { "id": "000-arithmetic", "path": "/ai/examples/000-arithmetic.eml.md", "title": "Arithmetic & augmented assign", "description": "Demonstrates the two-stage `^+` rule (declare then augment) and `^*` / `^0`." }, { "id": "001-summation", "path": "/ai/examples/001-summation.eml.md", "title": "Summation (Σ) over an inclusive range", "description": "The canonical EML demo: an algebraic-sum intent compressed into one symbol." }, { "id": "002-conditional", "path": "/ai/examples/002-conditional.eml.md", "title": "Conditional & membership", "description": "Ternary `?:` and inclusive-range membership (`in [1:100]` → `range(1, 101)`)." }, { "id": "003-coldhot", "path": "/ai/examples/003-coldhot.eml.md", "title": "Cold / hot functions", "description": "`@cold` pure logic becomes cacheable (`@functools.cache`, auto-imported); `@hot` is a marker only. Function definitions and `@cold` round-trip. `@hot` has one documented cosmetic exception." }, { "id": "004-closure", "path": "/ai/examples/004-closure.eml.md", "title": "Closures (nested functions)", "description": "A nested `def` captures the enclosing parameter `n` (lexical closure)." }, { "id": "005-recursion", "path": "/ai/examples/005-recursion.eml.md", "title": "Recursion", "description": "Self-recursive factorial via the ternary `?:`. `loopKind: recursive` (deterministic; not statically proven terminating)." }, { "id": "006-mvp-number-guessing-game", "path": "/ai/examples/006-mvp-number-guessing-game.eml.md", "title": "MVP proof: a second real, recognizable program ported to EML", "description": "`number_guessing_game.eml` is the second \"does EML actually work for something real\" test (see [`examples/mvp-tic-tac-toe/`](../mvp-tic-tac-toe/) for the first) — a genuine, independently-authored small program expressed end to end in EML: transpiled to Python, executed, and verified against real Python via the interpreter equivalence gate." }, { "id": "007-mvp-tic-tac-toe", "path": "/ai/examples/007-mvp-tic-tac-toe.eml.md", "title": "MVP proof: a real, recognizable program ported to EML", "description": "`tic_tac_toe.eml` is a \"does EML actually work for something real\" test — not a new-language-feature regression fixture like the other `examples/phaseN-*` directories, but a demonstration that a genuine, independently-authored small program can be expressed end to end in EML: transpiled to Python, executed, and verified against real Python via the interpreter equivalence gate." }, { "id": "008-todo-list-manager", "path": "/ai/examples/008-todo-list-manager.eml.md", "title": "Case corpus: a self-authored class-based todo-list manager", "description": "`todo_list_manager.eml` is the third case in a self-authored batch (see [`examples/unit-temperature-converter/`](../unit-temperature-converter/) and [`examples/word-frequency-counter/`](../word-frequency-counter/) for the other two) — part of growing the EML case corpus toward AI-native training scale, not a port of an existing project." }, { "id": "009-unit-temperature-converter", "path": "/ai/examples/009-unit-temperature-converter.eml.md", "title": "Case corpus: a self-authored unit-conversion program", "description": "`temperature_converter.eml` is the first case in a self-authored batch (see [`examples/word-frequency-counter/`](../word-frequency-counter/) and [`examples/todo-list-manager/`](../todo-list-manager/) for the other two) — part of growing the EML case corpus toward AI-native training scale, not a port of an existing project." }, { "id": "010-word-frequency-counter", "path": "/ai/examples/010-word-frequency-counter.eml.md", "title": "Case corpus: a self-authored word-frequency counter", "description": "`word_frequency_counter.eml` is the second case in a self-authored batch (see [`examples/unit-temperature-converter/`](../unit-temperature-converter/) and [`examples/todo-list-manager/`](../todo-list-manager/) for the other two) — part of growing the EML case corpus toward AI-native training scale, not a port of an existing project." }, { "id": "011-anagram-checker", "path": "/ai/examples/011-anagram-checker.eml.md", "title": "Anagram checker", "description": "`anagram_checker.eml` checks five sample word pairs — `listen`/`silent`, `evil`/`vile`, `dormitory`/`dirtyroom`, `night`/`thing`, and `cat`/`dog` — for whether each pair is an anagram of the other." }, { "id": "012-armstrong-number-checker", "path": "/ai/examples/012-armstrong-number-checker.eml.md", "title": "Armstrong number checker", "description": "`armstrong_number_checker.eml` checks whether each of four sample numbers (153, 370, 9474 — all genuine Armstrong numbers — and 123, which is not) is an Armstrong number: the sum of its digits, each raised to the power of the digit count, equals the number itself." }, { "id": "013-bank-account-simulator", "path": "/ai/examples/013-bank-account-simulator.eml.md", "title": "Case corpus: a self-authored bank account simulator", "description": "`bank_account_simulator.eml` is a class-based case in a self-authored batch of six OOP utilities (alongside `examples/simple-stack/`, `examples/simple-queue/`, `examples/inventory-tracker/`, `examples/library-catalog/`, and `examples/parking-lot-tracker/`) — part of growing the EML case corpus toward AI-native training scale, not a port of an existing project." }, { "id": "014-base-converter", "path": "/ai/examples/014-base-converter.eml.md", "title": "Base converter (decimal to binary/octal)", "description": "`base_converter.eml` converts three sample decimal integers (156, 2024, 45) to their binary and octal string representations by manual repeated-division-and-remainder — no `bin()`/`oct()`/`hex()` call is used; the digit string is built by hand." }, { "id": "015-caesar-cipher", "path": "/ai/examples/015-caesar-cipher.eml.md", "title": "Caesar cipher", "description": "`caesar_cipher.eml` encodes the sample message `\"Meet me at the old bridge at midnight\"` with a fixed shift-7 Caesar cipher, then decodes the result back to the original, printing all three lines (original / encoded / decoded) to demonstrate the round trip." }, { "id": "016-collatz-sequence", "path": "/ai/examples/016-collatz-sequence.eml.md", "title": "Collatz sequence", "description": "`collatz_sequence.eml` runs the Collatz conjecture step (halve if even, `3n + 1` if odd) from three starting numbers — 6, 11, and the famously long-running 27 (111 steps) — until each reaches 1, printing the full sequence and step count for every run." }, { "id": "017-contact-book", "path": "/ai/examples/017-contact-book.eml.md", "title": "Contact book", "description": "`contact_book.eml` is a small class-based `ContactBook` — add a contact, look one up, remove one — backed by a `self.contacts` dict mapping name to phone number." }, { "id": "018-dice-roll-tally", "path": "/ai/examples/018-dice-roll-tally.eml.md", "title": "Case corpus: a self-authored dice roll tally", "description": "`dice_roll_tally.eml` is one of a six-case self-authored batch of deterministic simulations and pattern generators (see [`examples/fizzbuzz/`](../fizzbuzz/), [`examples/multiplication-table-generator/`](../multiplication-table-generator/), [`examples/triangle-pattern-printer/`](../triangle-pattern-printer/), [`examples/simple-calculator/`](../simple-calculator/), and [`examples/rock-paper-scissors-simulator/`](../rock-paper-scissors-simulator/) for the other five) — part of growing the EML case corpus toward AI-native training scale, not a port of an existing project. EML's interpreter models no random-number generation, so the dice rolls here are a fixed, hardcoded 20-value list, not real randomness." }, { "id": "019-digit-sum-calculator", "path": "/ai/examples/019-digit-sum-calculator.eml.md", "title": "Digit sum + digital root calculator", "description": "`digit_sum_calculator.eml` takes a small list of sample integers and, for each one, computes its digit sum (the sum of its base-10 digits) and its \"digital root\" — the single digit left after repeatedly re-summing digits until only one remains." }, { "id": "020-duplicate-remover", "path": "/ai/examples/020-duplicate-remover.eml.md", "title": "Duplicate remover", "description": "`duplicate_remover.eml` removes duplicates from a sample grocery-basket list while preserving first-seen order — one of a seven-case self-authored batch of list/collection utilities for the EML case corpus (see [`examples/list-statistics/`](../list-statistics/), [`examples/list-rotator/`](../list-rotator/), [`examples/matrix-transpose-manual/`](../matrix-transpose-manual/), [`examples/intersection-union-finder/`](../intersection-union-finder/), [`examples/second-largest-finder/`](../second-largest-finder/), and [`examples/shopping-cart-total/`](../shopping-cart-total/) for the other six)." }, { "id": "021-fibonacci-sequence", "path": "/ai/examples/021-fibonacci-sequence.eml.md", "title": "Fibonacci sequence (iterative)", "description": "`fibonacci_sequence.eml` generates the first 15 Fibonacci numbers using a `while` loop with two running variables (`a`, `b`) that are swapped and advanced each iteration — deliberately iterative, since recursion is already covered elsewhere in this corpus (`examples/phase6-control-flow/` covers a similar iterative shape for a single Fibonacci value; this case generates the whole sequence as a list and prints both the full sequence and its last term)." }, { "id": "022-fizzbuzz", "path": "/ai/examples/022-fizzbuzz.eml.md", "title": "Case corpus: a self-authored FizzBuzz", "description": "`fizzbuzz.eml` is one of a six-case self-authored batch of deterministic simulations and pattern generators (see [`examples/multiplication-table-generator/`](../multiplication-table-generator/), [`examples/triangle-pattern-printer/`](../triangle-pattern-printer/), [`examples/simple-calculator/`](../simple-calculator/), [`examples/rock-paper-scissors-simulator/`](../rock-paper-scissors-simulator/), and [`examples/dice-roll-tally/`](../dice-roll-tally/) for the other five) — part of growing the EML case corpus toward AI-native training scale, not a port of an existing project." }, { "id": "023-gcd-lcm-calculator", "path": "/ai/examples/023-gcd-lcm-calculator.eml.md", "title": "GCD/LCM calculator", "description": "`gcd_lcm_calculator.eml` computes the greatest common divisor of two numbers via the classic iterative Euclidean algorithm, then derives the least common multiple from the GCD, for three realistic number pairs (e.g. two recurring events on 48-day and 18-day cycles next line up on their LCM)." }, { "id": "024-intersection-union-finder", "path": "/ai/examples/024-intersection-union-finder.eml.md", "title": "Intersection / union finder", "description": "`intersection_union_finder.eml` computes the intersection and union of two sample lists of team-roster names — one of a seven-case self-authored batch of list/collection utilities for the EML case corpus (see [`examples/list-statistics/`](../list-statistics/), [`examples/duplicate-remover/`](../duplicate-remover/), [`examples/list-rotator/`](../list-rotator/), [`examples/matrix-transpose-manual/`](../matrix-transpose-manual/), [`examples/second-largest-finder/`](../second-largest-finder/), and [`examples/shopping-cart-total/`](../shopping-cart-total/) for the other six)." }, { "id": "025-inventory-tracker", "path": "/ai/examples/025-inventory-tracker.eml.md", "title": "Case corpus: a self-authored stock inventory tracker", "description": "`inventory_tracker.eml` is a class-based case in a self-authored batch of six OOP utilities (alongside `examples/bank-account-simulator/`, `examples/simple-stack/`, `examples/simple-queue/`, `examples/library-catalog/`, and `examples/parking-lot-tracker/`) — part of growing the EML case corpus toward AI-native training scale, not a port of an existing project." }, { "id": "026-library-catalog", "path": "/ai/examples/026-library-catalog.eml.md", "title": "Case corpus: a self-authored library checkout catalog", "description": "`library_catalog.eml` is a class-based case in a self-authored batch of six OOP utilities (alongside `examples/bank-account-simulator/`, `examples/simple-stack/`, `examples/simple-queue/`, `examples/inventory-tracker/`, and `examples/parking-lot-tracker/`) — part of growing the EML case corpus toward AI-native training scale, not a port of an existing project." }, { "id": "027-list-rotator", "path": "/ai/examples/027-list-rotator.eml.md", "title": "List rotator", "description": "`list_rotator.eml` rotates two sample lists — a song playlist and a job queue — left and right by a given amount, using slice concatenation — one of a seven-case self-authored batch of list/collection utilities for the EML case corpus (see [`examples/list-statistics/`](../list-statistics/), [`examples/duplicate-remover/`](../duplicate-remover/), [`examples/matrix-transpose-manual/`](../matrix-transpose-manual/), [`examples/intersection-union-finder/`](../intersection-union-finder/), [`examples/second-largest-finder/`](../second-largest-finder/), and [`examples/shopping-cart-total/`](../shopping-cart-total/) for the other six)." }, { "id": "028-list-statistics", "path": "/ai/examples/028-list-statistics.eml.md", "title": "List statistics", "description": "`list_statistics.eml` computes the minimum, maximum, sum, and average of a sample list of hourly temperature readings — one of a seven-case self-authored batch of list/collection utilities for the EML case corpus (see [`examples/duplicate-remover/`](../duplicate-remover/), [`examples/list-rotator/`](../list-rotator/), [`examples/matrix-transpose-manual/`](../matrix-transpose-manual/), [`examples/intersection-union-finder/`](../intersection-union-finder/), [`examples/second-largest-finder/`](../second-largest-finder/), and [`examples/shopping-cart-total/`](../shopping-cart-total/) for the other six)." }, { "id": "029-matrix-transpose-manual", "path": "/ai/examples/029-matrix-transpose-manual.eml.md", "title": "Matrix transpose (manual)", "description": "`matrix_transpose_manual.eml` transposes a small 2x3 matrix, represented as a plain list of lists, via nested loops and manual index bookkeeping — one of a seven-case self-authored batch of list/collection utilities for the EML case corpus (see [`examples/list-statistics/`](../list-statistics/), [`examples/duplicate-remover/`](../duplicate-remover/), [`examples/list-rotator/`](../list-rotator/), [`examples/intersection-union-finder/`](../intersection-union-finder/), [`examples/second-largest-finder/`](../second-largest-finder/), and [`examples/shopping-cart-total/`](../shopping-cart-total/) for the other six)." }, { "id": "030-multiplication-table-generator", "path": "/ai/examples/030-multiplication-table-generator.eml.md", "title": "Case corpus: a self-authored multiplication table generator", "description": "`multiplication_table_generator.eml` is one of a six-case self-authored batch of deterministic simulations and pattern generators (see [`examples/fizzbuzz/`](../fizzbuzz/), [`examples/triangle-pattern-printer/`](../triangle-pattern-printer/), [`examples/simple-calculator/`](../simple-calculator/), [`examples/rock-paper-scissors-simulator/`](../rock-paper-scissors-simulator/), and [`examples/dice-roll-tally/`](../dice-roll-tally/) for the other five) — part of growing the EML case corpus toward AI-native training scale, not a port of an existing project." }, { "id": "031-palindrome-checker", "path": "/ai/examples/031-palindrome-checker.eml.md", "title": "Palindrome checker", "description": "`palindrome_checker.eml` checks whether each of six sample words — `level`, `radar`, `python`, `deified`, `civic`, `transpiler` — reads the same forwards and backwards, printing a verdict for each one." }, { "id": "032-parking-lot-tracker", "path": "/ai/examples/032-parking-lot-tracker.eml.md", "title": "Case corpus: a self-authored parking lot tracker", "description": "`parking_lot_tracker.eml` is a class-based case in a self-authored batch of six OOP utilities (alongside `examples/bank-account-simulator/`, `examples/simple-stack/`, `examples/simple-queue/`, `examples/inventory-tracker/`, and `examples/library-catalog/`) — part of growing the EML case corpus toward AI-native training scale, not a port of an existing project." }, { "id": "033-prime-checker", "path": "/ai/examples/033-prime-checker.eml.md", "title": "Prime checker", "description": "`prime_checker.eml` checks primality by trial division (dividing up to `sqrt(n)`, computed without a square-root call by comparing `divisor * divisor <= n`) for a handful of sample numbers, then separately builds the full list of primes up to 30 by looping over an inclusive range and growing a list." }, { "id": "034-quadratic-solver", "path": "/ai/examples/034-quadratic-solver.eml.md", "title": "Quadratic equation solver", "description": "`quadratic_solver.eml` solves `ax^2 + bx + c = 0` via the quadratic formula for three sample coefficient triples that all have real roots — `(1, -3, 2)` -> roots 1 and 2, `(2, -7, 3)` -> roots 0.5 and 3, `(1, -5, 6)` -> roots 2 and 3. The discriminant-negative (complex-root) case is deliberately skipped, as scoped for this case." }, { "id": "035-rock-paper-scissors-simulator", "path": "/ai/examples/035-rock-paper-scissors-simulator.eml.md", "title": "Case corpus: a self-authored rock-paper-scissors simulator", "description": "`rock_paper_scissors_simulator.eml` is one of a six-case self-authored batch of deterministic simulations and pattern generators (see [`examples/fizzbuzz/`](../fizzbuzz/), [`examples/multiplication-table-generator/`](../multiplication-table-generator/), [`examples/triangle-pattern-printer/`](../triangle-pattern-printer/), [`examples/simple-calculator/`](../simple-calculator/), and [`examples/dice-roll-tally/`](../dice-roll-tally/) for the other five) — part of growing the EML case corpus toward AI-native training scale, not a port of an existing project. EML's interpreter models no random-number generation, so the \"simulation\" here is a fixed, hardcoded sequence of six rounds, not real randomness." }, { "id": "036-run-length-encoder", "path": "/ai/examples/036-run-length-encoder.eml.md", "title": "Run-length encoder", "description": "`run_length_encoder.eml` run-length-encodes the DNA-style base sequence `\"AAAAGGGGCCCCTTTTAAAAGGA\"` (a genuine RLE use case — simple compression of repeated-symbol sequences, e.g. in bioinformatics or fax-style bitmap rows), producing `4A4G4C4T4A2G1A`." }, { "id": "037-second-largest-finder", "path": "/ai/examples/037-second-largest-finder.eml.md", "title": "Second-largest finder", "description": "`second_largest_finder.eml` finds the largest and second-largest *distinct* values in a sample list of exam scores (with repeats) via a manual single-pass loop tracking two running maxima — one of a seven-case self-authored batch of list/collection utilities for the EML case corpus (see [`examples/list-statistics/`](../list-statistics/), [`examples/duplicate-remover/`](../duplicate-remover/), [`examples/list-rotator/`](../list-rotator/), [`examples/matrix-transpose-manual/`](../matrix-transpose-manual/), [`examples/intersection-union-finder/`](../intersection-union-finder/), and [`examples/shopping-cart-total/`](../shopping-cart-total/) for the other six)." }, { "id": "038-shopping-cart-total", "path": "/ai/examples/038-shopping-cart-total.eml.md", "title": "Shopping cart total", "description": "`shopping_cart_total.eml` models a shopping cart as a list of `(item_name, unit_price, quantity)` tuples and prints an itemized receipt with a grand total — one of a seven-case self-authored batch of list/collection utilities for the EML case corpus (see [`examples/list-statistics/`](../list-statistics/), [`examples/duplicate-remover/`](../duplicate-remover/), [`examples/list-rotator/`](../list-rotator/), [`examples/matrix-transpose-manual/`](../matrix-transpose-manual/), [`examples/intersection-union-finder/`](../intersection-union-finder/), and [`examples/second-largest-finder/`](../second-largest-finder/) for the other six)." }, { "id": "039-simple-calculator", "path": "/ai/examples/039-simple-calculator.eml.md", "title": "Case corpus: a self-authored simple calculator", "description": "`simple_calculator.eml` is one of a six-case self-authored batch of deterministic simulations and pattern generators (see [`examples/fizzbuzz/`](../fizzbuzz/), [`examples/multiplication-table-generator/`](../multiplication-table-generator/), [`examples/triangle-pattern-printer/`](../triangle-pattern-printer/), [`examples/rock-paper-scissors-simulator/`](../rock-paper-scissors-simulator/), and [`examples/dice-roll-tally/`](../dice-roll-tally/) for the other five) — part of growing the EML case corpus toward AI-native training scale, not a port of an existing project." }, { "id": "040-simple-queue", "path": "/ai/examples/040-simple-queue.eml.md", "title": "Case corpus: a self-authored FIFO queue", "description": "`simple_queue.eml` is a class-based case in a self-authored batch of six OOP utilities (alongside `examples/bank-account-simulator/`, `examples/simple-stack/`, `examples/inventory-tracker/`, `examples/library-catalog/`, and `examples/parking-lot-tracker/`) — part of growing the EML case corpus toward AI-native training scale, not a port of an existing project." }, { "id": "041-simple-quiz-grader", "path": "/ai/examples/041-simple-quiz-grader.eml.md", "title": "Simple quiz grader", "description": "`simple_quiz_grader.eml` grades a 5-question quiz from `(question, correct_answer, given_answer)` tuples, printing per-question feedback and a final percentage score." }, { "id": "042-simple-stack", "path": "/ai/examples/042-simple-stack.eml.md", "title": "Case corpus: a self-authored LIFO stack", "description": "`simple_stack.eml` is a class-based case in a self-authored batch of six OOP utilities (alongside `examples/bank-account-simulator/`, `examples/simple-queue/`, `examples/inventory-tracker/`, `examples/library-catalog/`, and `examples/parking-lot-tracker/`) — part of growing the EML case corpus toward AI-native training scale, not a port of an existing project." }, { "id": "043-string-reverser", "path": "/ai/examples/043-string-reverser.eml.md", "title": "String reverser", "description": "`string_reverser.eml` reverses four sample strings — `\"Hello World\"`, `\"EML Transpiler\"`, `\"Neo.K\"`, `\"EveMissLab 2026\"`." }, { "id": "044-survey-score-analyzer", "path": "/ai/examples/044-survey-score-analyzer.eml.md", "title": "Survey score analyzer", "description": "`survey_score_analyzer.eml` analyzes a small customer-satisfaction survey — `(respondent_name, score)` tuples on a 1-10 scale — splitting respondents into satisfied/unsatisfied groups, averaging all scores, and previewing the first couple of responses." }, { "id": "045-task-priority-bucketer", "path": "/ai/examples/045-task-priority-bucketer.eml.md", "title": "Task priority bucketer", "description": "`task_priority_bucketer.eml` takes a sample task list — `(task_name, priority_number)` tuples on a 1-10 scale — and sorts them into high/medium/low priority buckets for a simple daily triage report." }, { "id": "046-temperature-alert-system", "path": "/ai/examples/046-temperature-alert-system.eml.md", "title": "Temperature alert system", "description": "`temperature_alert_system.eml` classifies a day's worth of hourly Celsius readings from a weather station into \"cold\"/\"mild\"/\"hot\" bands, prints a per-reading alert line (flagging severe extremes), and tallies how many readings landed in each band." }, { "id": "047-triangle-pattern-printer", "path": "/ai/examples/047-triangle-pattern-printer.eml.md", "title": "Case corpus: a self-authored triangle pattern printer", "description": "`triangle_pattern_printer.eml` is one of a six-case self-authored batch of deterministic simulations and pattern generators (see [`examples/fizzbuzz/`](../fizzbuzz/), [`examples/multiplication-table-generator/`](../multiplication-table-generator/), [`examples/simple-calculator/`](../simple-calculator/), [`examples/rock-paper-scissors-simulator/`](../rock-paper-scissors-simulator/), and [`examples/dice-roll-tally/`](../dice-roll-tally/) for the other five) — part of growing the EML case corpus toward AI-native training scale, not a port of an existing project." }, { "id": "048-vowel-consonant-counter", "path": "/ai/examples/048-vowel-consonant-counter.eml.md", "title": "Vowel/consonant counter", "description": "`vowel_consonant_counter.eml` counts vowels, consonants, and spaces in the sample sentence `\"the quick brown fox jumps over the lazy dog\"` and prints a small report." }, { "id": "049-word-capitalizer", "path": "/ai/examples/049-word-capitalizer.eml.md", "title": "Word capitalizer", "description": "`word_capitalizer.eml` title-cases the sample sentence `\"the quick brown fox jumps over the lazy dog\"` into `\"The Quick Brown Fox Jumps Over The Lazy Dog\"` without using a `.title()`/`.capitalize()` builtin." }, { "id": "050-binary-search", "path": "/ai/examples/050-binary-search.eml.md", "title": "Binary search", "description": "`binary_search.eml` searches for five sample targets (`34, 100, 3, 91, 50`) in the fixed pre-sorted list `[3, 8, 15, 22, 34, 41, 56, 63, 79, 91]` using a manual `while`-loop binary search — no `bisect` module." }, { "id": "051-bubble-sort", "path": "/ai/examples/051-bubble-sort.eml.md", "title": "Bubble sort", "description": "`bubble_sort.eml` sorts the sample list `[64, 34, 25, 12, 22, 11, 90]` into ascending order using a classic bubble sort — a manual double loop with an index-based adjacent-element swap — instead of the `sorted()`/`.sort()` builtins." }, { "id": "052-elevator-simulator", "path": "/ai/examples/052-elevator-simulator.eml.md", "title": "Elevator simulator", "description": "`elevator_simulator.eml` simulates a single elevator serving a fixed queue of floor requests (`5, 1, 8, 3`), starting at floor 0 and moving one floor per step toward its current target." }, { "id": "053-factorial-recursive", "path": "/ai/examples/053-factorial-recursive.eml.md", "title": "Factorial (recursive)", "description": "`factorial_recursive.eml` computes `0!` through `10!` via genuine self-recursion — a `factorial` function that calls itself — rather than an iterative loop." }, { "id": "054-insertion-sort", "path": "/ai/examples/054-insertion-sort.eml.md", "title": "Insertion sort", "description": "`insertion_sort.eml` sorts the sample list `[29, 10, 14, 37, 14, 5, 88]` (with a deliberate duplicate, `14`) into ascending order using insertion sort: builds the sorted prefix one element at a time by shifting larger elements right — the third simple sort in the corpus alongside [`examples/bubble-sort/`](../bubble-sort/) and [`examples/selection-sort/`](../selection-sort/)." }, { "id": "055-linear-search", "path": "/ai/examples/055-linear-search.eml.md", "title": "Linear search", "description": "`linear_search.eml` searches for five sample targets (`56, 100, 47, 89, 71`) in the fixed unsorted list `[47, 12, 89, 3, 56, 23, 89, 71]` via a single scanning loop with `break` on the first match — the natural counterpart to [`examples/binary-search/`](../binary-search/)'s pre-sorted, divide-and-conquer approach. The value `89` is deliberately repeated to demonstrate that linear search returns the *first* occurrence (index 2, not 6)." }, { "id": "056-merge-two-sorted-lists", "path": "/ai/examples/056-merge-two-sorted-lists.eml.md", "title": "Merge two sorted lists", "description": "`merge_two_sorted_lists.eml` merges two already-sorted sample lists (`[1, 4, 6, 9, 15]` and `[2, 3, 5, 8, 10, 20]`) into one sorted list via the classic two-pointer merge — the building block behind merge sort." }, { "id": "057-pascals-triangle", "path": "/ai/examples/057-pascals-triangle.eml.md", "title": "Pascal's triangle", "description": "`pascals_triangle.eml` generates the first 8 rows of Pascal's triangle, each row built from the previous one." }, { "id": "058-perfect-number-checker", "path": "/ai/examples/058-perfect-number-checker.eml.md", "title": "Perfect number checker", "description": "`perfect_number_checker.eml` checks whether six sample numbers (`6, 28, 12, 496, 100, 8128`) are perfect numbers — numbers whose proper divisors sum back to the number itself — via trial division. `6`, `28`, `496`, and `8128` are the first four perfect numbers; `12` and `100` are not." }, { "id": "059-power-recursive", "path": "/ai/examples/059-power-recursive.eml.md", "title": "Power (recursive)", "description": "`power_recursive.eml` computes `base^exponent` for five sample pairs (`2^10, 3^4, 5^0, 7^3, 10^6`) via genuine recursion — a `power` function that calls itself, decrementing the exponent each time." }, { "id": "060-prime-factorization", "path": "/ai/examples/060-prime-factorization.eml.md", "title": "Prime factorization", "description": "`prime_factorization.eml` finds the prime factorization (with multiplicity) of five sample numbers (`60, 97, 360, 1000000, 17`) via trial division — a manual nested `while` loop — no external number-theory library." }, { "id": "061-selection-sort", "path": "/ai/examples/061-selection-sort.eml.md", "title": "Selection sort", "description": "`selection_sort.eml` sorts the sample list `[64, 25, 12, 22, 11, 90, 34]` into ascending order using selection sort: for each position, scan the remainder for the minimum and swap it into place once — a different strategy from [`examples/bubble-sort/`](../bubble-sort/)'s repeated adjacent-element swap." }, { "id": "062-sum-of-digits-recursive", "path": "/ai/examples/062-sum-of-digits-recursive.eml.md", "title": "Sum of digits (recursive)", "description": "`sum_of_digits_recursive.eml` computes the digit sum of five sample numbers (`4527, 918273, 60, 999999, 7`) via genuine recursion — a `digit_sum` function that calls itself on the number with its last digit stripped off." }, { "id": "063-traffic-light-simulator", "path": "/ai/examples/063-traffic-light-simulator.eml.md", "title": "Traffic light simulator", "description": "`traffic_light_simulator.eml` simulates a traffic light cycling Red -> Green -> Yellow -> Red over 20 steps, each state held for a fixed number of steps (Red: 3, Green: 4, Yellow: 1)." }, { "id": "064-vending-machine-simulator", "path": "/ai/examples/064-vending-machine-simulator.eml.md", "title": "Vending machine simulator", "description": "`vending_machine_simulator.eml` simulates a vending machine processing four fixed purchases against a small product catalog (Soda 150, Chips 200, Candy 100, Water 125, in arbitrary currency units) — each purchase inserts a list of coins, accumulates a balance, and either dispenses the item with change or reports the shortfall." }, { "id": "065-binary-search-recursive", "path": "/ai/examples/065-binary-search-recursive.eml.md", "title": "Binary search (recursive)", "description": "`binary_search_recursive.eml` searches for the exact same five targets (`34, 100, 3, 91, 50`) in the exact same fixed pre-sorted list as [`examples/binary-search/`](../binary-search/) — same algorithm, same inputs, expressed via self-recursion instead of a `while` loop." }, { "id": "066-collatz-recursive", "path": "/ai/examples/066-collatz-recursive.eml.md", "title": "Collatz steps (recursive)", "description": "`collatz_recursive.eml` counts the number of Collatz-conjecture steps needed to reach `1`, for four sample starting numbers (`6, 11, 27, 1`)." }, { "id": "067-counting-sort", "path": "/ai/examples/067-counting-sort.eml.md", "title": "Counting sort", "description": "`counting_sort.eml` sorts a fixed sample list `[4, 2, 2, 8, 3, 3, 1, 0, 5]` (values known to be in `0..8`) via counting sort." }, { "id": "068-digital-root-recursive", "path": "/ai/examples/068-digital-root-recursive.eml.md", "title": "Digital root (recursive)", "description": "`digital_root_recursive.eml` computes the digital root (repeated digit-sum until one digit remains) of five sample numbers (`12345, 999, 8, 0, 132189`)." }, { "id": "069-door-lock-keypad-simulator", "path": "/ai/examples/069-door-lock-keypad-simulator.eml.md", "title": "Door lock keypad simulator", "description": "`door_lock_keypad_simulator.eml` simulates a keypad door lock through a fixed sequence of 6 PIN attempts, ending in a lockout." }, { "id": "070-euclidean-gcd-recursive", "path": "/ai/examples/070-euclidean-gcd-recursive.eml.md", "title": "Euclidean GCD (recursive)", "description": "`euclidean_gcd_recursive.eml` computes the greatest common divisor of five sample pairs (`(48,18)`, `(1071,462)`, `(17,5)`, `(100,75)`, `(0,9)`) via Euclid's algorithm." }, { "id": "071-fibonacci-recursive", "path": "/ai/examples/071-fibonacci-recursive.eml.md", "title": "Fibonacci (recursive)", "description": "`fibonacci_recursive.eml` prints `fib(0)` through `fib(10)` via genuine double-call self-recursion." }, { "id": "072-is-palindrome-recursive", "path": "/ai/examples/072-is-palindrome-recursive.eml.md", "title": "Is palindrome (recursive)", "description": "`is_palindrome_recursive.eml` checks six sample strings (`\"racecar\"`, `\"hello\"`, `\"level\"`, `\"python\"`, `\"a\"`, `\"\"`) for whether they read the same forwards and backwards." }, { "id": "073-jump-search", "path": "/ai/examples/073-jump-search.eml.md", "title": "Jump search", "description": "`jump_search.eml` searches for five sample targets (`34, 100, 3, 91, 999`) in the fixed pre-sorted list `[3, 8, 15, 22, 34, 41, 56, 63, 79, 91, 100, 108, 121]` via jump search." }, { "id": "074-merge-sort", "path": "/ai/examples/074-merge-sort.eml.md", "title": "Merge sort", "description": "`merge_sort.eml` sorts a fixed sample list `[8, 3, 5, 1, 9, 2, 7, 4, 6]` via classic recursive divide-and-conquer merge sort — no `sorted()` builtin." }, { "id": "075-quicksort-recursive", "path": "/ai/examples/075-quicksort-recursive.eml.md", "title": "Quicksort (recursive)", "description": "`quicksort_recursive.eml` sorts a fixed sample list `[5, 2, 9, 1, 5, 6, 3, 8, 4]` (with a repeated value) via recursive quicksort with Lomuto-style in-place partitioning." }, { "id": "076-reverse-string-recursive", "path": "/ai/examples/076-reverse-string-recursive.eml.md", "title": "Reverse string (recursive)", "description": "`reverse_string_recursive.eml` reverses five sample strings (`\"hello\"`, `\"EML\"`, `\"a\"`, `\"\"`, `\"racecar\"`)." }, { "id": "077-tower-of-hanoi", "path": "/ai/examples/077-tower-of-hanoi.eml.md", "title": "Tower of Hanoi", "description": "`tower_of_hanoi.eml` solves the classic Tower of Hanoi puzzle for 3 disks, moving them from peg `A` to peg `C` using peg `B` as auxiliary." }, { "id": "078-turnstile-simulator", "path": "/ai/examples/078-turnstile-simulator.eml.md", "title": "Turnstile simulator", "description": "`turnstile_simulator.eml` simulates a subway turnstile through a fixed sequence of 8 `push`/`coin` events, tracking coins collected and rejected pushes." }, { "id": "079-washing-machine-cycle-simulator", "path": "/ai/examples/079-washing-machine-cycle-simulator.eml.md", "title": "Washing machine cycle simulator", "description": "`washing_machine_cycle_simulator.eml` steps a washing machine through its fixed cycle (`fill -> wash -> rinse -> spin -> done`), each stage with its own duration, accumulating a running total." }, { "id": "080-balanced-brackets-checker", "path": "/ai/examples/080-balanced-brackets-checker.eml.md", "title": "Balanced brackets checker", "description": "`balanced_brackets_checker.eml` checks seven sample strings for correctly nested and matched brackets, covering the mismatched (`\"(]\"`), unclosed (`\"(((\"`), closer-before-opener (`\")(\"`), and empty (`\"\"`) edge cases as well as the well-formed ones." }, { "id": "081-binary-search-tree", "path": "/ai/examples/081-binary-search-tree.eml.md", "title": "Binary search tree", "description": "`binary_search_tree.eml` inserts `[50, 30, 70, 20, 40, 60, 80, 35]` into a BST, then walks it in-order to recover `[20, 30, 35, 40, 50, 60, 70, 80]` — the tree's defining property, demonstrated rather than asserted." }, { "id": "082-coin-change-dp", "path": "/ai/examples/082-coin-change-dp.eml.md", "title": "Coin change (dynamic programming)", "description": "`coin_change_dp.eml` finds the fewest coins that make a given amount, using a 1D DP table filled from 1 up to the target." }, { "id": "083-edit-distance", "path": "/ai/examples/083-edit-distance.eml.md", "title": "Edit distance (Levenshtein)", "description": "`edit_distance.eml` computes the fewest single-character insertions, deletions or substitutions needed to turn one string into another, for five sample pairs — including the canonical `'kitten' -> 'sitting' : 3`." }, { "id": "084-fibonacci-memoized", "path": "/ai/examples/084-fibonacci-memoized.eml.md", "title": "Fibonacci (memoized)", "description": "`fibonacci_memoized.eml` prints `fib(0)`..`fib(15)` and then `fib(50) = 12586269025`, using recursion with a dict cache." }, { "id": "085-graph-bfs-traversal", "path": "/ai/examples/085-graph-bfs-traversal.eml.md", "title": "Graph BFS traversal", "description": "`graph_bfs_traversal.eml` visits a small directed graph breadth-first from node `A`, reaching all 6 nodes in order `A, B, C, D, E, F`." }, { "id": "086-graph-dfs-recursive", "path": "/ai/examples/086-graph-dfs-recursive.eml.md", "title": "Graph DFS traversal (recursive)", "description": "`graph_dfs_recursive.eml` visits the **same graph** as [`examples/graph-bfs-traversal/`](../graph-bfs-traversal/) depth-first from node `A`, so the two orders can be read side by side:" }, { "id": "087-happy-number", "path": "/ai/examples/087-happy-number.eml.md", "title": "Happy number", "description": "`happy_number.eml` tests six numbers for \"happiness\": repeatedly replace a number with the sum of the squares of its digits, and it is happy if that process reaches 1 (`19 -> 82 -> 68 -> 100 -> 1`)." }, { "id": "088-longest-common-subsequence", "path": "/ai/examples/088-longest-common-subsequence.eml.md", "title": "Longest common subsequence", "description": "`longest_common_subsequence.eml` finds the longest sequence of characters appearing in both strings in order (not necessarily adjacent), for four sample pairs — including the textbook `'AGGTAB' & 'GXTXAYB' -> 'GTAB'`." }, { "id": "089-luhn-algorithm", "path": "/ai/examples/089-luhn-algorithm.eml.md", "title": "Luhn algorithm", "description": "`luhn_algorithm.eml` validates five numbers with the Luhn check-digit algorithm — the checksum behind credit-card and IMEI numbers." }, { "id": "090-matrix-multiplication", "path": "/ai/examples/090-matrix-multiplication.eml.md", "title": "Matrix multiplication", "description": "`matrix_multiplication.eml` multiplies a 2x3 matrix by a 3x2 matrix, producing the 2x2 product `[[58, 64], [139, 154]]`." }, { "id": "091-max-subarray-kadane", "path": "/ai/examples/091-max-subarray-kadane.eml.md", "title": "Maximum subarray (Kadane's algorithm)", "description": "`max_subarray_kadane.eml` finds the largest sum obtainable from any contiguous run of a list, for five samples — including the classic `[-2, 1, -3, 4, -1, 2, 1, -5, 4] -> 6`." }, { "id": "092-roman-numeral-converter", "path": "/ai/examples/092-roman-numeral-converter.eml.md", "title": "Roman numeral converter", "description": "`roman_numeral_converter.eml` converts ten sample integers to Roman numerals, spanning every subtractive form (`1994 -> MCMXCIV`, `3999 -> MMMCMXCIX`)." }, { "id": "093-rpn-evaluator", "path": "/ai/examples/093-rpn-evaluator.eml.md", "title": "Reverse Polish Notation evaluator", "description": "`rpn_evaluator.eml` evaluates four RPN expressions, e.g. `[3, 4, '+', 2, '*', 7, '/'] = 2` and `[5, 1, 2, '+', 4, '*', '+', 3, '-'] = 14`." }, { "id": "094-sieve-of-eratosthenes", "path": "/ai/examples/094-sieve-of-eratosthenes.eml.md", "title": "Sieve of Eratosthenes", "description": "`sieve_of_eratosthenes.eml` lists every prime up to 50 (15 of them) via the classic sieve." }, { "id": "095-bin-packing-first-fit", "path": "/ai/examples/095-bin-packing-first-fit.eml.md", "title": "Bin packing (first-fit)", "description": "`bin_packing_first_fit.eml` packs seven items into bins of capacity 10 by dropping each item into the first bin it still fits in, printing the resulting contents of every bin." }, { "id": "096-binary-heap", "path": "/ai/examples/096-binary-heap.eml.md", "title": "Binary heap (min-heap priority queue)", "description": "`binary_heap.eml` pushes `[5, 3, 8, 1, 9, 2, 7]` into a min-heap one at a time (printing the array after each push, so the heap property is visible) then drains it, recovering `[1, 2, 3, 5, 7, 8, 9]`." }, { "id": "097-conway-game-of-life", "path": "/ai/examples/097-conway-game-of-life.eml.md", "title": "Conway's Game of Life", "description": "`conway_game_of_life.eml` evolves a glider on a 6x6 grid for four generations, printing every generation." }, { "id": "098-day-of-week-zeller", "path": "/ai/examples/098-day-of-week-zeller.eml.md", "title": "Day of week (Zeller's congruence)", "description": "`day_of_week_zeller.eml` computes which weekday a calendar date falls on, arithmetically, with no date library — and checks all five results against independently known answers." }, { "id": "099-flood-fill", "path": "/ai/examples/099-flood-fill.eml.md", "title": "Flood fill", "description": "`flood_fill.eml` is the paint-bucket tool: starting from one cell, spread into the four orthogonal neighbors for as long as they still hold the original color. Prints the grid before and after, filling 13 cells from `(0,2)`." }, { "id": "100-hamming-distance", "path": "/ai/examples/100-hamming-distance.eml.md", "title": "Hamming distance", "description": "`hamming_distance.eml` counts how many positions two equal-length strings differ in, for five sample pairs — including the classic `'karolin' vs 'kathrin' : 3`." }, { "id": "101-linked-list-operations", "path": "/ai/examples/101-linked-list-operations.eml.md", "title": "Linked list operations", "description": "`linked_list_operations.eml` builds a four-node singly linked list, prints it, reverses it in place, and prints it again — showing the internal link array before and after." }, { "id": "102-longest-common-prefix", "path": "/ai/examples/102-longest-common-prefix.eml.md", "title": "Longest common prefix", "description": "`longest_common_prefix.eml` finds the longest starting string every word in a list shares, e.g. `['flower', 'flow', 'flight'] -> 'fl'`." }, { "id": "103-roman-to-integer", "path": "/ai/examples/103-roman-to-integer.eml.md", "title": "Roman numeral to integer", "description": "`roman_to_integer.eml` converts Roman numerals back to integers, and reports `10 of 10 round-tripped back to the original integer`." }, { "id": "104-spiral-matrix-traversal", "path": "/ai/examples/104-spiral-matrix-traversal.eml.md", "title": "Spiral matrix traversal", "description": "`spiral_matrix_traversal.eml` reads a matrix in a clockwise inward spiral, e.g. the 3x4 grid `1..12` comes out as `[1, 2, 3, 4, 8, 12, 11, 10, 9, 5, 6, 7]`." }, { "id": "105-stock-buy-sell-profit", "path": "/ai/examples/105-stock-buy-sell-profit.eml.md", "title": "Best single buy/sell profit", "description": "`stock_buy_sell_profit.eml` finds the best profit obtainable from buying once and selling once later, across five price series — e.g. `[7, 1, 5, 3, 6, 4] -> best profit 5` (buy at 1, sell at 6)." }, { "id": "106-substring-search", "path": "/ai/examples/106-substring-search.eml.md", "title": "Substring search (all positions)", "description": "`substring_search.eml` slides a pattern along a text and collects **every** match position, not just the first — e.g. `'aba' in 'abababa' -> [0, 2, 4]`." }, { "id": "107-topological-sort", "path": "/ai/examples/107-topological-sort.eml.md", "title": "Topological sort (Kahn's algorithm)", "description": "`topological_sort.eml` orders a course-prerequisite graph so every prerequisite comes before whatever needs it, then runs the same function against a deliberately impossible cyclic graph." }, { "id": "108-tournament-bracket", "path": "/ai/examples/108-tournament-bracket.eml.md", "title": "Tournament bracket", "description": "`tournament_bracket.eml` runs a single-elimination tournament: pair up adjacent teams, the stronger rating advances, repeat on the surviving half until one team is left. Eight teams take exactly three rounds." }, { "id": "109-vigenere-cipher", "path": "/ai/examples/109-vigenere-cipher.eml.md", "title": "Vigenère cipher", "description": "`vigenere_cipher.eml` encodes `\"attack at dawn\"` with the key `\"lemon\"` to `\"lxfopv ef rnhr\"`, then decodes it back — the textbook example, letter for letter." }, { "id": "110-bisection-root-finder", "path": "/ai/examples/110-bisection-root-finder.eml.md", "title": "Bisection root finder", "description": "`bisection_root_finder.eml` finds roots by halving an interval whose endpoints give the function opposite signs — a root must lie between them." }, { "id": "111-days-between-dates", "path": "/ai/examples/111-days-between-dates.eml.md", "title": "Days between dates", "description": "`days_between_dates.eml` counts the days between two calendar dates by converting each to a day number since a fixed epoch and subtracting." }, { "id": "112-fraction-arithmetic", "path": "/ai/examples/112-fraction-arithmetic.eml.md", "title": "Fraction arithmetic (exact rationals)", "description": "`fraction_arithmetic.eml` adds and multiplies fractions held as `[numerator, denominator]` pairs, always reduced by their greatest common divisor." }, { "id": "113-histogram-builder", "path": "/ai/examples/113-histogram-builder.eml.md", "title": "Histogram builder", "description": "`histogram_builder.eml` buckets 20 scores into equal-width ranges and draws each bucket as a bar:" }, { "id": "114-manual-csv-parser", "path": "/ai/examples/114-manual-csv-parser.eml.md", "title": "Manual CSV parser", "description": "`manual_csv_parser.eml` splits CSV lines into fields one character at a time, tracking whether the scan is currently inside a quoted region." }, { "id": "115-matrix-determinant", "path": "/ai/examples/115-matrix-determinant.eml.md", "title": "Matrix determinant (cofactor expansion)", "description": "`matrix_determinant.eml` computes determinants by expanding along the top row and recursing on each minor, checked against five independently known answers." }, { "id": "116-maze-solver-backtracking", "path": "/ai/examples/116-maze-solver-backtracking.eml.md", "title": "Maze solver (backtracking)", "description": "`maze_solver_backtracking.eml` finds a route through a 6x6 maze from the top-left to the bottom-right, then renders the board with the path marked:" }, { "id": "117-modular-exponentiation", "path": "/ai/examples/117-modular-exponentiation.eml.md", "title": "Modular exponentiation", "description": "`modular_exponentiation.eml` computes `base^exponent mod m` by repeated squaring — the operation underneath RSA and Diffie-Hellman." }, { "id": "118-moving-average", "path": "/ai/examples/118-moving-average.eml.md", "title": "Moving average (sliding window)", "description": "`moving_average.eml` computes a moving average incrementally — the first window is summed once, and every window after it adds the entering value and subtracts the leaving one." }, { "id": "119-n-queens", "path": "/ai/examples/119-n-queens.eml.md", "title": "N-Queens", "description": "`n_queens.eml` places N queens on an NxN board so none attacks another, for N = 4, 5, 6 — then renders all four 6-queens solutions." }, { "id": "120-newton-sqrt", "path": "/ai/examples/120-newton-sqrt.eml.md", "title": "Newton's method for square roots", "description": "`newton_sqrt.eml` computes square roots by repeatedly averaging a guess with `value / guess`, and prints the convergence step by step:" }, { "id": "121-permutations-generator", "path": "/ai/examples/121-permutations-generator.eml.md", "title": "Permutations generator", "description": "`permutations_generator.eml` produces every ordering of a list — all 6 of `[\"A\",\"B\",\"C\"]`, then confirms 24 for a four-item list." }, { "id": "122-rank-with-ties", "path": "/ai/examples/122-rank-with-ties.eml.md", "title": "Ranking with ties", "description": "`rank_with_ties.eml` ranks a leaderboard containing two pairs of tied scores, under both standard conventions at once:" }, { "id": "123-subset-sum-backtracking", "path": "/ai/examples/123-subset-sum-backtracking.eml.md", "title": "Subset sum (backtracking)", "description": "`subset_sum_backtracking.eml` finds every subset of `[3, 34, 4, 12, 5, 2]` adding up to 9 — `[3, 4, 2]` and `[4, 5]` — then shows that nothing reaches 100." }, { "id": "124-sudoku-solver-4x4", "path": "/ai/examples/124-sudoku-solver-4x4.eml.md", "title": "Sudoku solver (4x4)", "description": "`sudoku_solver_4x4.eml` solves a 4x4 Sudoku from four clues, then checks its own answer with an independent validator." }, { "id": "125-arithmetic-series-sigma", "path": "/ai/examples/125-arithmetic-series-sigma.eml.md", "title": "Arithmetic series (Σ)", "description": "`arithmetic_series_sigma.eml` sums arithmetic progressions with EML's summation operator, checking every result against a closed form." }, { "id": "126-bank-account-invariant", "path": "/ai/examples/126-bank-account-invariant.eml.md", "title": "A class that defends an invariant", "description": "`bank_account_invariant.eml` keeps one rule — the balance is never negative — and raises rather than returning a status when asked to break it." }, { "id": "127-cold-cache-key-identity", "path": "/ai/examples/127-cold-cache-key-identity.eml.md", "title": "What counts as \"the same arguments\"", "description": "`cold_cache_key_identity.eml` measures which argument values share a `@cold` cache entry. The obvious guess — Python equality, so `1 == 1.0 == True` is one entry — is wrong, and wrong in a way that depends on **how many arguments the function takes**." }, { "id": "128-cold-memoization-visible", "path": "/ai/examples/128-cold-memoization-visible.eml.md", "title": "@cold, made visible", "description": "`cold_memoization_visible.eml` is the corpus's **first use of EML's temperature model**. The 124 programs before it used neither `@cold` nor `@hot`, despite those being among EML's most distinctive features." }, { "id": "129-cold-stale-state", "path": "/ai/examples/129-cold-stale-state.eml.md", "title": "When @cold changes the answer", "description": "`cold_stale_state.eml` is the other half of [`examples/cold-vs-hot-fibonacci/`](../cold-vs-hot-fibonacci/). That case makes the reassuring point — for a genuinely pure function, `@cold` and `@hot` agree on every value and differ only in cost. This one makes the point that actually bites." }, { "id": "130-cold-vs-hot-fibonacci", "path": "/ai/examples/130-cold-vs-hot-fibonacci.eml.md", "title": "@cold vs @hot: same answers, different costs", "description": "`cold_vs_hot_fibonacci.eml` writes the same recursive Fibonacci twice — once `@cold`, once `@hot` — to separate two things the temperature model does not confuse." }, { "id": "131-dot-product-sigma", "path": "/ai/examples/131-dot-product-sigma.eml.md", "title": "Dot product (Σ)", "description": "`dot_product_sigma.eml` computes vector dot products as a summation over paired list positions." }, { "id": "132-duck-typed-shapes", "path": "/ai/examples/132-duck-typed-shapes.eml.md", "title": "Polymorphism without inheritance", "description": "`duck_typed_shapes.eml` dispatches `area()` across five unrelated classes." }, { "id": "133-exception-finally-ordering", "path": "/ai/examples/133-exception-finally-ordering.eml.md", "title": "try / except / finally ordering", "description": "`exception_finally_ordering.eml` prints the order these actually run in, rather than describing it." }, { "id": "134-harmonic-series-sigma", "path": "/ai/examples/134-harmonic-series-sigma.eml.md", "title": "Harmonic series (Σ)", "description": "`harmonic_series_sigma.eml` computes harmonic numbers `H(n) = Σ(1/i, i in [1:n])` — a summation over a **float** summand." }, { "id": "135-hot-mutable-input", "path": "/ai/examples/135-hot-mutable-input.eml.md", "title": "Why @hot exists", "description": "`hot_mutable_input.eml` argues that `@hot` is a **correctness** annotation that happens to disable an optimisation — not an optimisation annotation that happens to be a no-op." }, { "id": "136-retry-until-success", "path": "/ai/examples/136-retry-until-success.eml.md", "title": "Retry loops", "description": "`retry_until_success.eml` uses exceptions for control flow rather than for reporting a crash." }, { "id": "137-sum-of-squares-sigma", "path": "/ai/examples/137-sum-of-squares-sigma.eml.md", "title": "Sum of squares (Σ)", "description": "`sum_of_squares_sigma.eml` computes `Σ(i^2, i in [1:n])` for five values of `n`, checking each against the closed form `n(n+1)(2n+1)/6`." }, { "id": "138-ternary-decision-table", "path": "/ai/examples/138-ternary-decision-table.eml.md", "title": "Ternary chains", "description": "`ternary_decision_table.eml` exercises EML's `cond ? a : b`, which the corpus had almost no coverage of before this." }, { "id": "139-variance-with-sigma", "path": "/ai/examples/139-variance-with-sigma.eml.md", "title": "Variance two ways (Σ)", "description": "`variance_with_sigma.eml` computes population variance with two algebraically identical summations, and shows them disagreeing." }, { "id": "140-comprehension-pipeline", "path": "/ai/examples/140-comprehension-pipeline.eml.md", "title": "List comprehensions, and what they do differently", "description": "`comprehension_pipeline.eml` examines list comprehensions — four corpus programs had used one, none had looked at it." }, { "id": "141-continue-and-break-filters", "path": "/ai/examples/141-continue-and-break-filters.eml.md", "title": "`continue` and `break` are not symmetric", "description": "`continue_and_break_filters.eml` pins the interaction of the two loop escapes — used by two and nine corpus programs respectively, and never examined together." }, { "id": "142-dict-inventory-report", "path": "/ai/examples/142-dict-inventory-report.eml.md", "title": "Dictionaries as the primary structure", "description": "`dict_inventory_report.eml` builds an inventory around a dict — seven corpus programs used a dict literal, none of them centrally." }, { "id": "143-exception-suppressing-manager", "path": "/ai/examples/143-exception-suppressing-manager.eml.md", "title": "`__exit__`'s return value decides everything", "description": "`exception_suppressing_manager.eml` isolates the part of the context-manager protocol that surprises people." }, { "id": "144-indented-report-writer", "path": "/ai/examples/144-indented-report-writer.eml.md", "title": "A context manager that isn't about resources", "description": "`indented_report_writer.eml` uses `with` to manage the *shape of output* rather than to release anything." }, { "id": "145-manager-enter-failure", "path": "/ai/examples/145-manager-enter-failure.eml.md", "title": "When cleanup does *not* run", "description": "`manager_enter_failure.eml` covers the context-manager rule almost nobody states, and the one that decides whether \"cleanup always runs\" is actually true." }, { "id": "146-multiline-help-text", "path": "/ai/examples/146-multiline-help-text.eml.md", "title": "Triple-quoted strings, and the whitespace they capture", "description": "`multiline_help_text.eml` uses triple-quoted string literals, which EML has supported since Phase 9 and which no corpus program had used." }, { "id": "147-receipt-formatter", "path": "/ai/examples/147-receipt-formatter.eml.md", "title": "A receipt, and what `%` rounding actually does", "description": "`receipt_formatter.eml` is the smallest honest excuse to use every part of `%`-formatting at once: left-aligned names, right-aligned integers, fixed two-decimal money, and a percentage." }, { "id": "148-resource-guard-with", "path": "/ai/examples/148-resource-guard-with.eml.md", "title": "Cleanup that cannot be skipped (`with`)", "description": "`resource_guard_with.eml` is the corpus's **first use of `with`**. EML has had context managers with a real `__enter__`/`__exit__` protocol since Phase 9, and in 134 programs not one of them used it." }, { "id": "149-run-length-encoding", "path": "/ai/examples/149-run-length-encoding.eml.md", "title": "A round-trip property that found a broken format", "description": "`run_length_encoding.eml` implements RLE and its inverse, and checks them against each other rather than against hand-written expected strings." }, { "id": "150-set-membership-dedup", "path": "/ai/examples/150-set-membership-dedup.eml.md", "title": "What a set is for, and what it costs", "description": "`set_membership_dedup.eml` covers set literals — used incidentally by the corpus, never examined — and the one thing they are unambiguously for: asking *have I seen this before* without scanning." }, { "id": "151-slice-toolkit", "path": "/ai/examples/151-slice-toolkit.eml.md", "title": "Slicing is half-open, and that's the whole story", "description": "`slice_toolkit.eml` works through slicing, which five corpus programs had touched only in passing." }, { "id": "152-text-banner-builder", "path": "/ai/examples/152-text-banner-builder.eml.md", "title": "Sequence repetition", "description": "`text_banner_builder.eml` covers `\"-\" * n` and `[0] * n` — which no corpus program had used, and which is the workhorse behind every box, rule, bar chart and padded column." }, { "id": "153-transaction-rollback-with", "path": "/ai/examples/153-transaction-rollback-with.eml.md", "title": "All-or-nothing, with rollback", "description": "`transaction_rollback_with.eml` is the pattern `with` exists for: a change that either fully happens or fully doesn't, decided by how the block was left." }, { "id": "154-word-wrap", "path": "/ai/examples/154-word-wrap.eml.md", "title": "Greedy word wrap", "description": "`word_wrap.eml` implements the algorithm behind every terminal that reflows text, using the string tools EML actually has." }, { "id": "155-absolute-error-tracker", "path": "/ai/examples/155-absolute-error-tracker.eml.md", "title": "Absolute error tracker", "description": "`absolute_error_tracker.eml` compares five readings against a target and reports which ones fall outside a tolerance band." }, { "id": "156-attendance-register", "path": "/ai/examples/156-attendance-register.eml.md", "title": "Updating a key does not move it", "description": "`attendance_register.eml` keeps an attendance dict as instance state on a class, updated one mark at a time." }, { "id": "157-char-frequency-table", "path": "/ai/examples/157-char-frequency-table.eml.md", "title": "Counting with a dict, in first-appearance order", "description": "`char_frequency_table.eml` tallies the characters of a phrase and prints a bar chart." }, { "id": "158-config-defaults-merge", "path": "/ai/examples/158-config-defaults-merge.eml.md", "title": "Presence is not truthiness", "description": "`config_defaults_merge.eml` layers user settings over defaults, and shows the mistake that makes this harder than it looks." }, { "id": "159-coordinate-distance-table", "path": "/ai/examples/159-coordinate-distance-table.eml.md", "title": "Points are tuples", "description": "`coordinate_distance_table.eml` measures four points against the origin, two ways." }, { "id": "160-exam-score-records", "path": "/ai/examples/160-exam-score-records.eml.md", "title": "A list of tuples is a table", "description": "`exam_score_records.eml` holds `(name, score, attempts)` rows and reports on them." }, { "id": "161-inventory-ledger", "path": "/ai/examples/161-inventory-ledger.eml.md", "title": "A dict iterates in insertion order", "description": "`inventory_ledger.eml` compares stock levels against reorder floors and prints a report by walking the dict." }, { "id": "162-min-max-selection", "path": "/ai/examples/162-min-max-selection.eml.md", "title": "`min()` and `max()` have two call shapes", "description": "`min_max_selection.eml` demonstrates the rule that decides which one you are using, and the sharp edge it creates." }, { "id": "163-numeric-string-parser", "path": "/ai/examples/163-numeric-string-parser.eml.md", "title": "What `int()` and `float()` actually accept", "description": "`numeric_string_parser.eml` walks fourteen candidate strings and reports, for each, what `int()` and `float()` do with it." }, { "id": "164-polynomial-evaluator", "path": "/ai/examples/164-polynomial-evaluator.eml.md", "title": "A polynomial as (coefficient, exponent) pairs", "description": "`polynomial_evaluator.eml` evaluates `2x^3 - 4x^2 + 7x + 5` at four points by summing its terms explicitly." }, { "id": "165-rgb-palette-blender", "path": "/ai/examples/165-rgb-palette-blender.eml.md", "title": "Blending colours, one channel at a time", "description": "`rgb_palette_blender.eml` adds and scales `(r, g, b)` tuples with each channel clamped independently." }, { "id": "166-running-total-sum", "path": "/ai/examples/166-running-total-sum.eml.md", "title": "`sum()` is less boring than it looks", "description": "`running_total_sum.eml` exercises the three behaviours of `sum()` that matter and are easy to get wrong." }, { "id": "167-tuple-vs-list-choice", "path": "/ai/examples/167-tuple-vs-list-choice.eml.md", "title": "Tuple or list?", "description": "`tuple_vs_list_choice.eml` states the rule and demonstrates both halves of it in one program." }, { "id": "168-unique-tag-collector", "path": "/ai/examples/168-unique-tag-collector.eml.md", "title": "Sets answer questions; lists produce sequences", "description": "`unique_tag_collector.eml` counts distinct tags and demonstrates the one thing EML-P deliberately **refuses** to do with a set." }, { "id": "169-word-length-grouping", "path": "/ai/examples/169-word-length-grouping.eml.md", "title": "Grouping into lists, not counters", "description": "`word_length_grouping.eml` buckets words by length — the other half of the dict-as-accumulator pattern, where the values are lists that grow rather than numbers that increment." }, { "id": "170-feature-flag-rollout", "path": "/ai/examples/170-feature-flag-rollout.eml.md", "title": "Promotion as a subset question", "description": "`feature_flag_rollout.eml` — compares feature flags across environments." }, { "id": "171-frozen-membership-quirk", "path": "/ai/examples/171-frozen-membership-quirk.eml.md", "title": "A set you can ask about but never store", "description": "`frozen_membership_quirk.eml` — isolates one genuine CPython quirk." }, { "id": "172-grid-coordinate-map", "path": "/ai/examples/172-grid-coordinate-map.eml.md", "title": "A grid keyed by (row, col)", "description": "`grid_coordinate_map.eml` — a sparse grid whose keys are coordinate tuples." }, { "id": "173-hashable-key-rules", "path": "/ai/examples/173-hashable-key-rules.eml.md", "title": "What can be a key", "description": "`hashable_key_rules.eml` — shows which values can key a dict or join a set, and what the failure says." }, { "id": "174-inventory-diff-report", "path": "/ai/examples/174-inventory-diff-report.eml.md", "title": "Difference is directional", "description": "`inventory_diff_report.eml` — reconciles two stock snapshots." }, { "id": "175-memo-key-tuples", "path": "/ai/examples/175-memo-key-tuples.eml.md", "title": "Why a tuple key, not a joined string", "description": "`memo_key_tuples.eml` — memoises a two-argument function by hand." }, { "id": "176-move-history-log", "path": "/ai/examples/176-move-history-log.eml.md", "title": "Tuples doing two jobs at once", "description": "`move_history_log.eml` — logs game moves as tuples inside a tuple." }, { "id": "177-partial-order-trap", "path": "/ai/examples/177-partial-order-trap.eml.md", "title": "Sorting by a partial order", "description": "`partial_order_trap.eml` — runs the same sort over the same sets in two input orders." }, { "id": "178-pattern-tiler", "path": "/ai/examples/178-pattern-tiler.eml.md", "title": "Repetition preserves the type", "description": "`pattern_tiler.eml` — tiles a pattern to fill a width." }, { "id": "179-percent-format-arguments", "path": "/ai/examples/179-percent-format-arguments.eml.md", "title": "What `%` does with its right operand", "description": "`percent_format_arguments.eml` — walks the argument rules of %-formatting." }, { "id": "180-permission-set-algebra", "path": "/ai/examples/180-permission-set-algebra.eml.md", "title": "For sets, `<` means subset", "description": "`permission_set_algebra.eml` — models roles and permissions with set algebra." }, { "id": "181-prerequisite-checker", "path": "/ai/examples/181-prerequisite-checker.eml.md", "title": "\"Are all requirements met\" is a subset test", "description": "`prerequisite_checker.eml` — checks course eligibility." }, { "id": "182-route-path-builder", "path": "/ai/examples/182-route-path-builder.eml.md", "title": "Extending a path without mutating it", "description": "`route_path_builder.eml` — builds a route by concatenating tuples." }, { "id": "183-set-order-discipline", "path": "/ai/examples/183-set-order-discipline.eml.md", "title": "What you may and may not ask a set", "description": "`set_order_discipline.eml` — states the line between order-free and order-dependent set operations." }, { "id": "184-type-preserving-ops", "path": "/ai/examples/184-type-preserving-ops.eml.md", "title": "One operator, four meanings", "description": "`type_preserving_ops.eml` — shows what `+` and `*` mean per operand family." }, { "id": "185-bracket-tree-outline", "path": "/ai/examples/185-bracket-tree-outline.eml.md", "title": "Bracket tree: the round trip is the proof", "description": "`bracket_tree_outline.eml` parses a bracketed string into a tree, renders it as an indented outline, and serialises it back." }, { "id": "186-connection-pool-release", "path": "/ai/examples/186-connection-pool-release.eml.md", "title": "Connection pool: release on every exit path", "description": "`connection_pool_release.eml` is a lease-based connection pool whose releases are driven by a context manager. It exists to answer one question: does the release still happen when the body does **not** fall off the end?" }, { "id": "187-event-router-ignored-branches", "path": "/ai/examples/187-event-router-ignored-branches.eml.md", "title": "Event router: branches that do nothing, on purpose", "description": "`event_router_ignored_branches.eml` routes four kinds of event and **deliberately ignores two of them**." }, { "id": "188-factorial-exact-digits", "path": "/ai/examples/188-factorial-exact-digits.eml.md", "title": "50! exactly, checked four ways", "description": "`factorial_exact_digits.eml` computes 50! and then checks it against facts known independently of the multiplication that produced it." }, { "id": "189-fibonacci-cassini-exact", "path": "/ai/examples/189-fibonacci-cassini-exact.eml.md", "title": "Fibonacci to F(200), checked with Cassini", "description": "`fibonacci_cassini_exact.eml` builds Fibonacci numbers to F(200) and checks them with an identity a float implementation cannot pass and cannot fake." }, { "id": "190-long-division-exact", "path": "/ai/examples/190-long-division-exact.eml.md", "title": "Exact integer division, by hand", "description": "`long_division_exact.eml` implements exact integer division digit by digit, **because EML-P has no `//` operator**." }, { "id": "191-money-in-cents", "path": "/ai/examples/191-money-in-cents.eml.md", "title": "The same invoice, in floats and in cents", "description": "`money_in_cents.eml` totals one invoice twice — in floating-point dollars and in integer cents — and reconciles both against a bank that only accepts whole cents." }, { "id": "192-nested-config-merge", "path": "/ai/examples/192-nested-config-merge.eml.md", "title": "Deep config merge: the sibling that disappears", "description": "`nested_config_merge.eml` merges layered configuration — defaults, then overrides — the way every “defaults, environment, command line” system has to." }, { "id": "193-pascal-row-exact", "path": "/ai/examples/193-pascal-row-exact.eml.md", "title": "Row 80 of Pascal’s triangle, exactly", "description": "`pascal_row_exact.eml` builds row 80 of Pascal's triangle by addition and checks it against three global properties." }, { "id": "194-recursive-descent-calculator", "path": "/ai/examples/194-recursive-descent-calculator.eml.md", "title": "Recursive descent: precedence lives in the nesting", "description": "`recursive_descent_calculator.eml` parses and evaluates arithmetic expressions with real operator precedence, parentheses, unary minus and error reporting." }, { "id": "195-retry-with-backoff-ledger", "path": "/ai/examples/195-retry-with-backoff-ledger.eml.md", "title": "Retry with backoff, and the ledger that audits it", "description": "`retry_with_backoff_ledger.eml` implements exponential-backoff retry and then proves the retry loop did not lie about what it did." }, { "id": "196-ring-buffer-bounds-report", "path": "/ai/examples/196-ring-buffer-bounds-report.eml.md", "title": "Ring buffer: telling a bad read from a bad write", "description": "`ring_buffer_bounds_report.eml` is a fixed-capacity ring buffer whose error handler tells reads and writes apart **by reading the message**." }, { "id": "197-shift-roster-constraints", "path": "/ai/examples/197-shift-roster-constraints.eml.md", "title": "Shift roster: the builder does not get to grade itself", "description": "`shift_roster_constraints.eml` builds a weekly roster greedily under four hard constraints, then audits the finished roster against those same constraints re-derived from scratch." }, { "id": "198-thermostat-class-defaults", "path": "/ai/examples/198-thermostat-class-defaults.eml.md", "title": "Thermostats: a factory default shared until it is overridden", "description": "`thermostat_class_defaults.eml` models the shape every settings object has — a default on the **class**, a per-object override on the **instance** — and checks that the boundary between them holds." }, { "id": "199-transaction-rollback-finally", "path": "/ai/examples/199-transaction-rollback-finally.eml.md", "title": "Transaction log: `finally` as the only thing holding the books", "description": "`transaction_rollback_finally.eml` is a small transaction log in which `finally` is the only thing standing between a half-applied batch and a consistent one." }, { "id": "200-base32-codec-padding", "path": "/ai/examples/200-base32-codec-padding.eml.md", "title": "The padding table is the whole specification", "description": "`base32_codec_padding.eml` is a hand-written Base32 codec, and the only hard part is how many `=` characters go on the end." }, { "id": "201-dict-key-identity-collapse", "path": "/ai/examples/201-dict-key-identity-collapse.eml.md", "title": "Three keys that are one key", "description": "`dict_key_identity_collapse.eml` is about `{1: \"int\", 1.0: \"float\", True: \"bool\"}` having one entry, and the asymmetry that makes it hard to see." }, { "id": "202-dimensional-unit-guard", "path": "/ai/examples/202-dimensional-unit-guard.eml.md", "title": "A factor table will convert metres to seconds", "description": "`dimensional_unit_guard.eml` converts between units and refuses to convert between dimensions - which is the part a factor table cannot do." }, { "id": "203-fixed-width-record-parser", "path": "/ai/examples/203-fixed-width-record-parser.eml.md", "title": "Fixed-width records: where clamping does the most damage", "description": "`fixed_width_record_parser.eml` parses column-offset records — the format in which a truncated line and a valid line are indistinguishable after the slices have run." }, { "id": "204-iban-mod97-validator", "path": "/ai/examples/204-iban-mod97-validator.eml.md", "title": "Mod 97 on a number too big to hold", "description": "`iban_mod97_validator.eml` validates IBANs by the ISO 13616 rule - rearrange, expand letters to digits, take the whole thing mod 97 - and does it twice, because the number does not fit anywhere." }, { "id": "205-interval-overlap-detector", "path": "/ai/examples/205-interval-overlap-detector.eml.md", "title": "Back-to-back is not an overlap", "description": "`interval_overlap_detector.eml` decides whether two time intervals overlap, and the whole case is one comparison operator." }, { "id": "206-longest-palindromic-run", "path": "/ai/examples/206-longest-palindromic-run.eml.md", "title": "Longest palindrome: an off-by-one that produces a longer answer", "description": "`longest_palindromic_run.eml` finds the longest palindromic substring by expanding around every centre, and never trusts what it extracts." }, { "id": "207-rotate-without-step", "path": "/ai/examples/207-rotate-without-step.eml.md", "title": "Rotation: the two-slice idiom, and why it needs a modulo", "description": "`rotate_without_step.eml` rotates a sequence with two slices and reverses one without a step — because EML-P slices take two parts and `xs[::-1]` does not parse." }, { "id": "208-run-length-escaping", "path": "/ai/examples/208-run-length-escaping.eml.md", "title": "The fix that feels right and makes it worse", "description": "`run_length_escaping.eml` implements run-length encoding three ways, and the point is that the middle one - the obvious fix - is worse than the bug it was meant to repair." }, { "id": "209-schema-validator-all-errors", "path": "/ai/examples/209-schema-validator-all-errors.eml.md", "title": "Report every error, not the first one", "description": "`schema_validator_all_errors.eml` validates records against a small schema twice - stopping at the first problem, and collecting all of them - and checks the thing that separates the two." }, { "id": "210-sliding-window-slices", "path": "/ai/examples/210-sliding-window-slices.eml.md", "title": "Sliding windows: the bug is always at the ends", "description": "`sliding_window_slices.eml` builds sliding windows over a sequence entirely from slices, and checks them where every windowing bug lives — at the two boundaries." }, { "id": "211-sort-stability-witness", "path": "/ai/examples/211-sort-stability-witness.eml.md", "title": "Sorted is not the same as stable", "description": "`sort_stability_witness.eml` runs two insertion sorts that differ by one character, verifies both sort correctly, and shows only one of them is usable." }, { "id": "212-state-machine-trace-audit", "path": "/ai/examples/212-state-machine-trace-audit.eml.md", "title": "Two different ways for a log to be illegal", "description": "`state_machine_trace_audit.eml` replays an event log against a state machine and reports what the machine did with each event - rather than whether the log as a whole is valid." }, { "id": "213-text-truncate-ellipsis", "path": "/ai/examples/213-text-truncate-ellipsis.eml.md", "title": "Truncating with an ellipsis: three silent bugs in one line", "description": "`text_truncate_ellipsis.eml` truncates text to a column budget, and shows what the four-line version everyone writes actually does." }, { "id": "214-verhoeff-check-digit", "path": "/ai/examples/214-verhoeff-check-digit.eml.md", "title": "A checksum that notices order", "description": "`verhoeff_check_digit.eml` implements the Verhoeff check digit and measures the thing it does that Luhn cannot." }, { "id": "215-at-least-once-delivery", "path": "/ai/examples/215-at-least-once-delivery.eml.md", "title": "Duplicates are a property of the handler", "description": "`at_least_once_delivery.eml` replays a delivery log with known redeliveries through three handlers and compares each against the answer computed from the distinct messages alone." }, { "id": "216-average-of-averages", "path": "/ai/examples/216-average-of-averages.eml.md", "title": "Winning every group and losing the company", "description": "`average_of_averages.eml` computes a company-wide rate two ways over the same data and shows the two disagree about which method is better." }, { "id": "217-cache-staleness-witness", "path": "/ai/examples/217-cache-staleness-witness.eml.md", "title": "Evicting the key you wrote is not enough", "description": "`cache_staleness_witness.eml` replays a write history against three cache-invalidation strategies and asks every question after every write." }, { "id": "218-case-fold-collisions", "path": "/ai/examples/218-case-fold-collisions.eml.md", "title": "Two ways to lose a user, one of them silent", "description": "`case_fold_collisions.eml` folds usernames for uniqueness three ways and measures each against a separately stated ground truth about who is who." }, { "id": "219-comparator-not-a-total-order", "path": "/ai/examples/219-comparator-not-a-total-order.eml.md", "title": "Sorted twelve different ways", "description": "`comparator_not_a_total_order.eml` sorts one multiset under three comparators, over every permutation of the input, and counts the distinct answers." }, { "id": "220-error-masked-by-finally", "path": "/ai/examples/220-error-masked-by-finally.eml.md", "title": "Cleanup that deletes the reason", "description": "`error_masked_by_finally.eml` runs the same failing operation through four `try/finally` shapes and reports what the caller actually observes." }, { "id": "221-float-key-instability", "path": "/ai/examples/221-float-key-instability.eml.md", "title": "Three wrong premises about floating point", "description": "`float_key_instability.eml` looks values up in a table keyed by a number that was computed rather than typed, and records the three premises it started from — all wrong." }, { "id": "222-idempotence-witness", "path": "/ai/examples/222-idempotence-witness.eml.md", "title": "Safe once, not safe twice", "description": "`idempotence_witness.eml` applies four cleanup routines up to five times each and checks the property that every retry depends on: `f(f(x)) == f(x)`." }, { "id": "223-lost-update-schedule", "path": "/ai/examples/223-lost-update-schedule.eml.md", "title": "Every interleaving, written down", "description": "`lost_update_schedule.eml` enumerates all 20 interleavings of two read-modify-write transactions and runs three strategies over every one." }, { "id": "224-memo-key-collision", "path": "/ai/examples/224-memo-key-collision.eml.md", "title": "The cache key that answers the wrong question", "description": "`memo_key_collision.eml` memoizes a two-argument function three ways and measures which of the three keys is a key at all." }, { "id": "225-partial-parse-accepted", "path": "/ai/examples/225-partial-parse-accepted.eml.md", "title": "The parser that reads as far as it understands", "description": "`partial_parse_accepted.eml` compares two parsers for the same grammar, differing by one check: whether the whole input was consumed." }, { "id": "226-partial-write-rollback", "path": "/ai/examples/226-partial-write-rollback.eml.md", "title": "Validating first is not a way back", "description": "`partial_write_rollback.eml` replays a transfer history against three write strategies and checks the one invariant that can see the damage." }, { "id": "227-successive-percentage-order", "path": "/ai/examples/227-successive-percentage-order.eml.md", "title": "Three tiers of commuting, and only one is safe", "description": "`successive_percentage_order.eml` applies promotion stacks in every order over several prices and counts the distinct outcomes." }, { "id": "228-timeout-vs-completion", "path": "/ai/examples/228-timeout-vs-completion.eml.md", "title": "A timeout is a fact about the client", "description": "`timeout_vs_completion.eml` sweeps a matrix of when the server finishes against how long the client waits, under three client policies." }, { "id": "229-top-n-undefined-tiebreak", "path": "/ai/examples/229-top-n-undefined-tiebreak.eml.md", "title": "The top three is not a set", "description": "`top_n_undefined_tiebreak.eml` computes \"the top three\" four ways over every permutation of a leaderboard with a three-way tie." }, { "id": "230-absent-vs-empty-vs-zero", "path": "/ai/examples/230-absent-vs-empty-vs-zero.eml.md", "title": "Three kinds of nothing, one falsy value", "description": "`absent_vs_empty_vs_zero.eml` merges a user config over defaults three ways and compares each against a separately stated intent." }, { "id": "231-apportionment-remainder", "path": "/ai/examples/231-apportionment-remainder.eml.md", "title": "Every part rounded correctly, and the total is wrong", "description": "`apportionment_remainder.eml` allocates a whole across shares three ways and checks that the parts sum back to the whole." }, { "id": "232-base-conversion-roundtrip", "path": "/ai/examples/232-base-conversion-roundtrip.eml.md", "title": "Round-tripping and canonicality are different claims", "description": "`base_conversion_roundtrip.eml` encodes and decodes integers in every base from 2 to 16 and checks two separate properties." }, { "id": "233-boundary-inclusive-or-not", "path": "/ai/examples/233-boundary-inclusive-or-not.eml.md", "title": "Four readings of one sentence, differing on two values", "description": "`boundary_inclusive_or_not.eml` compares the four interval conventions and checks the property consecutive ranges need." }, { "id": "234-catastrophic-cancellation", "path": "/ai/examples/234-catastrophic-cancellation.eml.md", "title": "Same algebra, and one arrangement keeps its digits", "description": "`catastrophic_cancellation.eml` computes variance, a quadratic root and a difference of squares two ways each, against an exact reference." }, { "id": "235-counter-vs-histogram", "path": "/ai/examples/235-counter-vs-histogram.eml.md", "title": "The percentile you threw away at write time", "description": "`counter_vs_histogram.eml` summarises two workloads with the same mean and very different tails, then tries to recover the percentiles from each summary." }, { "id": "236-empty-input-conventions", "path": "/ai/examples/236-empty-input-conventions.eml.md", "title": "Four empty answers are forced; the fifth has none", "description": "`empty_input_conventions.eml` checks each aggregate's empty-input answer against the law that forces it." }, { "id": "237-event-order-without-clock", "path": "/ai/examples/237-event-order-without-clock.eml.md", "title": "Most pairs right, and the ones that matter inverted", "description": "`event_order_without_clock.eml` reconstructs an event order from timestamps written by two clocks that disagree, and checks it against causality." }, { "id": "238-fixed-width-overflow", "path": "/ai/examples/238-fixed-width-overflow.eml.md", "title": "Correct in Python, wrong everywhere it will be ported", "description": "`fixed_width_overflow.eml` implements 32-bit signed arithmetic explicitly and runs the same computations both ways." }, { "id": "239-integer-division-sign", "path": "/ai/examples/239-integer-division-sign.eml.md", "title": "Two right answers to -7 / 2", "description": "`integer_division_sign.eml` implements truncating division alongside Python's floor division and checks both against the identity that defines them." }, { "id": "240-log-sampling-bias", "path": "/ai/examples/240-log-sampling-bias.eml.md", "title": "Same number of records, different questions", "description": "`log_sampling_bias.eml` samples a request stream two ways and measures which questions each sample can still answer." }, { "id": "241-metric-cardinality-explosion", "path": "/ai/examples/241-metric-cardinality-explosion.eml.md", "title": "A label that looked like it had five values", "description": "`metric_cardinality_explosion.eml` counts the time series each labelling produces and compares them against what the label domains predict." }, { "id": "242-percentage-points-vs-percent", "path": "/ai/examples/242-percentage-points-vs-percent.eml.md", "title": "Points add and reverse; relative changes do not", "description": "`percentage_points_vs_percent.eml` distinguishes the two units hiding behind \"it went up 2%\", in integer basis points so no float enters the comparison." }, { "id": "243-silent-drop-accounting", "path": "/ai/examples/243-silent-drop-accounting.eml.md", "title": "Same output, and only one can say what went missing", "description": "`silent_drop_accounting.eml` runs a four-stage pipeline twice — once plain, once with a ledger — and reconciles the counts." }, { "id": "244-text-length-is-three-numbers", "path": "/ai/examples/244-text-length-is-three-numbers.eml.md", "title": "One character, three lengths", "description": "`text_length_is_three_numbers.eml` measures the same strings in code points, UTF-8 bytes and terminal columns." }, { "id": "245-whitespace-normalization-loss", "path": "/ai/examples/245-whitespace-normalization-loss.eml.md", "title": "All three are idempotent; only one is lossless", "description": "`whitespace_normalization_loss.eml` compares trim, collapse and strip-all as normalizers, and checks the property each actually needs." }, { "id": "246-age-at-date-leap-day", "path": "/ai/examples/246-age-at-date-leap-day.eml.md", "title": "Age at a date — three defensible answers on 29 February", "description": "`age_at_date_leap_day.eml` computes age four ways and compares them against a reference table written from the definition rather than from any of the implementations." }, { "id": "247-backoff-thundering-herd", "path": "/ai/examples/247-backoff-thundering-herd.eml.md", "title": "Backoff and the thundering herd — a policy that synchronises load", "description": "`backoff_thundering_herd.eml` retries 100 clients after a shared outage under four policies — fixed, exponential, jittered, decorrelated — and reports the **peak** concurrent retry count, not the average." }, { "id": "248-bounded-queue-backpressure", "path": "/ai/examples/248-bounded-queue-backpressure.eml.md", "title": "Bounded queue backpressure — a bigger buffer is not more capacity", "description": "`bounded_queue_backpressure.eml` runs one burst arrival pattern through three full-queue policies — drop-newest, drop-oldest, block — at three queue sizes, and reports loss, stalls, and the age of what was served." }, { "id": "249-cache-eviction-policy", "path": "/ai/examples/249-cache-eviction-policy.eml.md", "title": "Cache eviction policy — the workload decides, not the policy", "description": "`cache_eviction_policy.eml` runs LRU, LFU and FIFO over three access traces chosen because each defeats a different policy, and compares all three against the offline (Belady) optimum." }, { "id": "250-date-parse-ambiguity", "path": "/ai/examples/250-date-parse-ambiguity.eml.md", "title": "Date parse ambiguity — information that is not in the string", "description": "`date_parse_ambiguity.eml` parses slashed dates under DD/MM and MM/DD and measures how far apart the two readings land." }, { "id": "251-deadlock-by-lock-order", "path": "/ai/examples/251-deadlock-by-lock-order.eml.md", "title": "Deadlock by lock order — the defect that exists only in the pair", "description": "`deadlock_by_lock_order.eml` enumerates every interleaving of two transactions that take the same two locks in opposite orders, then repeats the enumeration with a consistent global lock order." }, { "id": "252-leader-lease-expiry", "path": "/ai/examples/252-leader-lease-expiry.eml.md", "title": "Leader lease expiry — two leaders, no bug", "description": "`leader_lease_expiry.eml` runs a lease-based leader election under clock skew and sweeps the guard band to find the value that eliminates both overlap (two leaders) and gap (no leader)." }, { "id": "253-local-time-gap-and-overlap", "path": "/ai/examples/253-local-time-gap-and-overlap.eml.md", "title": "Local time gap and overlap — a label, not an instant", "description": "`local_time_gap_and_overlap.eml` maps local times to instants across a spring-forward and an autumn-back transition, and counts how many local times survive a round trip." }, { "id": "254-month-end-arithmetic", "path": "/ai/examples/254-month-end-arithmetic.eml.md", "title": "Month-end arithmetic — two correct answers to \"renew monthly\"", "description": "`month_end_arithmetic.eml` renews a subscription that started on 31 January twelve times, two ways: by stepping forward one month at a time, and by adding *n* months to the original start date." }, { "id": "255-pagination-shifting-data", "path": "/ai/examples/255-pagination-shifting-data.eml.md", "title": "Pagination over shifting data — the skip nobody notices", "description": "`pagination_shifting_data.eml` walks a collection page by page with a row inserted or deleted *before the window* between requests, under offset pagination and keyset (cursor) pagination." }, { "id": "256-partitioned-queue-ordering", "path": "/ai/examples/256-partitioned-queue-ordering.eml.md", "title": "Partitioned queue ordering — the order you routed on, and no other", "description": "`partitioned_queue_ordering.eml` routes a stream of related events through 1 to 6 partitions and counts two different kinds of ordering violation: within a partition key, and across keys." }, { "id": "257-rate-limit-window-shape", "path": "/ai/examples/257-rate-limit-window-shape.eml.md", "title": "Rate limit window shape — three limiters, three actual limits", "description": "`rate_limit_window_shape.eml` replays a boundary-exploiting client through a fixed window, a sliding window and two token buckets, and reports the largest number of requests admitted in **any** 60-tick span." }, { "id": "258-timeout-budget-across-hops", "path": "/ai/examples/258-timeout-budget-across-hops.eml.md", "title": "Timeout budget across hops — four 5-second timeouts are not a 5-second bound", "description": "`timeout_budget_across_hops.eml` sends a request across four services under fixed per-hop timeouts and under a propagated deadline, and reports the user's wait, whether it succeeded, and how much work ran after the caller had already given up." }, { "id": "259-two-phase-commit-window", "path": "/ai/examples/259-two-phase-commit-window.eml.md", "title": "Two-Phase Commit — the in-doubt window", "description": "`two_phase_commit_window.eml` runs 2PC through a coordinator crash at every point in the protocol, under three participant strategies for what to do while in doubt: wait, presume-abort, presume-commit." }, { "id": "260-week-numbering-conventions", "path": "/ai/examples/260-week-numbering-conventions.eml.md", "title": "Week numbering conventions — \"week 1\" is at least three weeks", "description": "`week_numbering_conventions.eml` sweeps a year day by day under ISO, \"simple\" (week 1 starts 1 January) and US (weeks start Sunday) numbering, and checks the properties a week number needs to work as a grouping key." }, { "id": "261-base-rate-and-precision", "path": "/ai/examples/261-base-rate-and-precision.eml.md", "title": "Base rate and precision — 99% accurate, and most alerts are false", "description": "`base_rate_and_precision.eml` holds a test fixed at 99% sensitivity and 99% specificity, sweeps the base rate, and reports precision at each one." }, { "id": "262-leading-zero-identifiers", "path": "/ai/examples/262-leading-zero-identifiers.eml.md", "title": "Leading-zero identifiers — two customers, one key", "description": "`leading_zero_identifiers.eml` runs real-shaped identifiers through an integer round trip and counts three separate failures: identifiers that do not come back as themselves, distinct identifiers that **collide**, and identifiers that lose digits to float precision." }, { "id": "263-mean-median-skew", "path": "/ai/examples/263-mean-median-skew.eml.md", "title": "Mean, median, skew — the average nobody experienced", "description": "`mean_median_skew.eml` computes three \"averages\" over a skewed latency sample and a symmetric control, and measures two things a report never shows: what fraction of observations are worse than the mean, and how far one extreme value moves each statistic." }, { "id": "264-money-float-accumulation", "path": "/ai/examples/264-money-float-accumulation.eml.md", "title": "Money in floats — a difference that prints as -0.00", "description": "`money_float_accumulation.eml` adds the same money two ways — as floats and as integer cents — over runs of 10 to 2000 items, and reports equality, the direction of the gap, and what a reconciliation report would print." }, { "id": "265-non-transitive-comparator", "path": "/ai/examples/265-non-transitive-comparator.eml.md", "title": "Non-transitive comparator — three answers, and the postcondition likes all of them", "description": "`non_transitive_comparator.eml` runs three sorting algorithms over every permutation of a comparator with a three-element cycle, and counts distinct outputs." }, { "id": "266-percent-composition", "path": "/ai/examples/266-percent-composition.eml.md", "title": "Percent composition — a positive average quarter and a losing year", "description": "`percent_composition.eml` composes sequences of percentage changes and compares the arithmetic mean of the periods against the actual total." }, { "id": "267-percentile-composition", "path": "/ai/examples/267-percentile-composition.eml.md", "title": "Percentile composition — every backend meets its p99, one request in ten is slow", "description": "`percentile_composition.eml` computes the p99 of a request that fans out to N backends and waits for all of them, exactly, with no simulation." }, { "id": "268-rounding-rule-drift", "path": "/ai/examples/268-rounding-rule-drift.eml.md", "title": "Rounding rule drift — why banks use the rule that looks arbitrary", "description": "`rounding_rule_drift.eml` rounds every half from 0 to 20 under four tie-breaking rules and measures the drift each one introduces into the total." }, { "id": "269-simpsons-paradox", "path": "/ai/examples/269-simpsons-paradox.eml.md", "title": "Simpson's paradox — a treatment that wins every group and loses overall", "description": "`simpsons_paradox.eml` compares two treatments on two kinds of case. A has a better success rate on easy cases **and** on hard cases. B has a better rate overall." }, { "id": "270-sort-key-mismatch-binary-search", "path": "/ai/examples/270-sort-key-mismatch-binary-search.eml.md", "title": "Sort key mismatch — the list is sorted, the item is in it, the search says no", "description": "`sort_key_mismatch_binary_search.eml` searches a case-insensitively sorted list with a case-sensitive comparison and counts how many present items come back \"not found\"." }, { "id": "271-survivorship-in-cohorts", "path": "/ai/examples/271-survivorship-in-cohorts.eml.md", "title": "Survivorship in cohorts — satisfaction rises as the product gets worse", "description": "`survivorship_in_cohorts.eml` tracks three quantities over eight periods of a steadily worsening product: how many users remain, their average tolerance, and their average headroom." }, { "id": "272-tolerance-equality-grouping", "path": "/ai/examples/272-tolerance-equality-grouping.eml.md", "title": "Tolerance equality — no implementation is wrong, because nothing is right", "description": "`tolerance_equality_grouping.eml` groups values under a \"close enough to be the same\" relation two ways, over several orderings of the same input." }, { "id": "273-top-n-with-ties", "path": "/ai/examples/273-top-n-with-ties.eml.md", "title": "Top-N with ties — four people tied for third", "description": "`top_n_with_ties.eml` asks for the top 3 from a list where four entries share the third-place score, under three defensible policies, over several orderings of the same data." }, { "id": "274-unstable-sort-secondary-key", "path": "/ai/examples/274-unstable-sort-secondary-key.eml.md", "title": "Unstable sort, secondary key — sorted by department, names out of order", "description": "`unstable_sort_secondary_key.eml` runs the two-pass sorting idiom — sort by name, then sort by department — with a stable and an unstable second pass, and counts how many departments kept their names in order." }, { "id": "275-version-string-ordering", "path": "/ai/examples/275-version-string-ordering.eml.md", "title": "Version string ordering — correct until the tenth release", "description": "`version_string_ordering.eml` sorts one version list three ways — as text, by numeric component, and by numeric component with missing parts padded to zero — and counts how many ordered **pairs** the rules disagree on." }, { "id": "276-cache-stampede-single-flight", "path": "/ai/examples/276-cache-stampede-single-flight.eml.md", "title": "Cache stampede — the hotter the key, the bigger the crowd at expiry", "description": "`cache_stampede_single_flight.eml` replays one arrival pattern across expiry boundaries under four policies and counts three costs separately: recomputations, requests that **waited**, and requests served **stale**." }, { "id": "277-cost-model-mismatch", "path": "/ai/examples/277-cost-model-mismatch.eml.md", "title": "Cost model mismatch — a limit of 100 items, and the resource is bytes", "description": "`cost_model_mismatch.eml` runs four workloads through a count limit, a byte limit, and a combined limit, and reports the **maximum** bytes admitted under each." }, { "id": "278-fair-share-vs-fifo", "path": "/ai/examples/278-fair-share-vs-fifo.eml.md", "title": "Fair share vs FIFO — a queue discipline picks who it is fair to", "description": "`fair_share_vs_fifo.eml` runs one arrival pattern — 20 jobs from one tenant, 1 each from five others — through FIFO and fair queuing, and reports the wait per **tenant** alongside the mean per **job**." }, { "id": "279-fixture-avoids-the-boundary", "path": "/ai/examples/279-fixture-avoids-the-boundary.eml.md", "title": "Fixture avoids the boundary — which values can detect an off-by-one", "description": "`fixture_avoids_the_boundary.eml` sweeps every integer in a window across a correct implementation and three off-by-one variants, and reports which values distinguish which." }, { "id": "280-flaky-quarantine-drift", "path": "/ai/examples/280-flaky-quarantine-drift.eml.md", "title": "Flaky quarantine drift — a green pipeline and a third of the gate gone", "description": "`flaky_quarantine_drift.eml` runs the quarantine process week by week and records three quantities: the active suite's pass rate, the number of active tests, and the number of **defects the active suite would still catch**." }, { "id": "281-idempotency-key-reuse", "path": "/ai/examples/281-idempotency-key-reuse.eml.md", "title": "Idempotency key reuse — the key says retry and the body says otherwise", "description": "`idempotency_key_reuse.eml` runs a request log containing genuine retries, key reuse with a changed body, and unrelated requests through three policies, and counts three outcomes separately." }, { "id": "282-mock-ignores-input", "path": "/ai/examples/282-mock-ignores-input.eml.md", "title": "A mock that ignores its input — the double agreed with every caller", "description": "`mock_ignores_input.eml` runs four deliberately broken callers against three test doubles and counts how many each one catches." }, { "id": "283-mutation-survival", "path": "/ai/examples/283-mutation-survival.eml.md", "title": "Mutation survival — the test that runs the most lines checks the least", "description": "`mutation_survival.eml` runs one suite against three mutants of one function and reports which tests kill which, alongside the coverage each test achieves." }, { "id": "284-new-enum-value-fallthrough", "path": "/ai/examples/284-new-enum-value-fallthrough.eml.md", "title": "New enum value fallthrough — the else branch answers for a case it never saw", "description": "`new_enum_value_fallthrough.eml` asks four consumers the same question about every value in an old enum and then about a value added afterwards, and classifies each answer as right, silently wrong, or a loud failure." }, { "id": "285-pool-reentrancy-deadlock", "path": "/ai/examples/285-pool-reentrancy-deadlock.eml.md", "title": "Pool reentrancy deadlock — at capacity means deadlocked", "description": "`pool_reentrancy_deadlock.eml` sweeps concurrency against pool size for requests holding one, two and three connections, and reports the first concurrency at which progress becomes impossible." }, { "id": "286-retry-amplification", "path": "/ai/examples/286-retry-amplification.eml.md", "title": "Retry amplification — three retries at three layers is twenty-seven", "description": "`retry_amplification.eml` computes the bottom-layer request count for every combination of depth and per-layer attempts, and compares retrying at every layer against retrying at the edge only." }, { "id": "287-retry-masked-flakiness", "path": "/ai/examples/287-retry-masked-flakiness.eml.md", "title": "Retry-masked flakiness — one failure in five reports as 99.2%", "description": "`retry_masked_flakiness.eml` sweeps true failure rates against attempt counts and computes the observed pass rate exactly, in integer per-mille arithmetic." }, { "id": "288-soft-delete-and-uniqueness", "path": "/ai/examples/288-soft-delete-and-uniqueness.eml.md", "title": "Soft delete and uniqueness — the row is gone and the address is taken", "description": "`soft_delete_and_uniqueness.eml` runs sign-ups, deletions and re-sign-ups against four schemes and counts two errors separately: registrations **wrongly refused**, and duplicate **active** accounts wrongly allowed." }, { "id": "289-state-from-events-vs-stored", "path": "/ai/examples/289-state-from-events-vs-stored.eml.md", "title": "State from events vs stored — replay is correct only for some orders", "description": "`state_from_events_vs_stored.eml` applies every ordering of one event set and counts distinct final states, then does the same for a stored status column written by whichever handler finished last." }, { "id": "290-status-field-conflation", "path": "/ai/examples/290-status-field-conflation.eml.md", "title": "Status field conflation — the states that cannot be written down", "description": "`status_field_conflation.eml` enumerates an order's real state space as the product of two independent dimensions and marks which points a single status enum can name." }, { "id": "291-admin-bypass-skips-validation", "path": "/ai/examples/291-admin-bypass-skips-validation.eml.md", "title": "Admin bypass skips validation — an early return is a jump, not a permission", "description": "`admin_bypass_skips_validation.eml` pushes the same seven-record migration payload through two save paths under three roles, then reads the store back and re-validates every row that is in it." }, { "id": "292-count-leaks-hidden-items", "path": "/ai/examples/292-count-leaks-hidden-items.eml.md", "title": "Count leaks hidden items — the rows were filtered and the total was not", "description": "`count_leaks_hidden_items.eml` pages through a listing as four viewers, compares what the header claims against what the pages deliver, and then runs the attack that difference enables." }, { "id": "293-dedup-key-merges-distinct-records", "path": "/ai/examples/293-dedup-key-merges-distinct-records.eml.md", "title": "Dedup key merges distinct records — both curves rose, and one was being watched", "description": "`dedup_key_merges_distinct_records.eml` sweeps four key definitions from strict to loose over seven records carrying ground-truth entity ids, and scores each key on duplicates joined, strangers joined, and duplicates missed." }, { "id": "294-deleted-row-survives-in-derived-copies", "path": "/ai/examples/294-deleted-row-survives-in-derived-copies.eml.md", "title": "Deleted row survives in derived copies — the delete succeeded against the one surface nobody searches", "description": "`deleted_row_survives_in_derived_copies.eml` deletes a record and then interrogates each surface the way a user reaches it, reporting which ones still return content. It also runs the deletion audit the system has." }, { "id": "295-denormalized-total-drifts", "path": "/ai/examples/295-denormalized-total-drifts.eml.md", "title": "Denormalized total drifts — the reconciliation compared a number with itself", "description": "`denormalized_total_drifts.eml` applies one ordinary edit to each of four orders, compares the stored total against a total recomputed from the line items, and then runs both the reconciliation the system has and one that re-derives." }, { "id": "296-deny-loses-to-allow", "path": "/ai/examples/296-deny-loses-to-allow.eml.md", "title": "Deny loses to allow — the role that cannot take anything away", "description": "`deny_loses_to_allow.eml` computes each user's effective permissions two ways — as a **union of grants** and with **deny winning** — and then sweeps the structural question directly: can attaching a role ever remove a permission?" }, { "id": "297-flag-outlives-its-evidence", "path": "/ai/examples/297-flag-outlives-its-evidence.eml.md", "title": "Flag outlives its evidence — the conclusion stayed and the link back was never stored", "description": "`flag_outlives_its_evidence.eml` starts from a stored flag set that is consistent with the evidence by construction, retracts two signals and adds one, then re-derives every flag and splits the disagreements by direction." }, { "id": "298-inherited-permission-after-move", "path": "/ai/examples/298-inherited-permission-after-move.eml.md", "title": "Inherited permission after move — the cache refreshes on write, and a move is not a write", "description": "`inherited_permission_after_move.eml` moves four documents between folders and compares, for every (user, action) pair, the grants cached on the document against the grants its current folder actually gives." }, { "id": "299-match-predicate-not-transitive", "path": "/ai/examples/299-match-predicate-not-transitive.eml.md", "title": "Match predicate not transitive — there is no grouping to be right about", "description": "`match_predicate_not_transitive.eml` sweeps **all 24 orderings** of four records through a single-pass clusterer, counts how many distinct answers come out, then asks the transitive closure for its answer and checks it against the predicate that produced it." }, { "id": "300-merge-drops-the-differing-field", "path": "/ai/examples/300-merge-drops-the-differing-field.eml.md", "title": "Merge drops the differing field — a gap and a contradiction are the same shape in the code", "description": "`merge_drops_the_differing_field.eml` merges four record pairs field by field with \"first non-empty wins\", then re-runs every merge with the two sources swapped and counts how many merged fields change." }, { "id": "301-merge-invents-a-match", "path": "/ai/examples/301-merge-invents-a-match.eml.md", "title": "Merge invents a match — one sweep wrote a value no record held, the next believed it", "description": "`merge_invents_a_match.eml` runs a dedup job one sweep at a time and, for every merge, asks whether any original member of one side matched any original member of the other under the same matcher. It compares against the identical job with normalisation moved to compare time." }, { "id": "302-path-resolved-twice", "path": "/ai/examples/302-path-resolved-twice.eml.md", "title": "Path resolved twice — the check and the write agreed on the name, not the document", "description": "`path_resolved_twice.eml` runs three requests against every point at which a rename can be interleaved, under two handlers: one that resolves the name twice (once to authorise, once to act) and one that resolves it once and carries the identity." }, { "id": "303-rate-numerator-outgrows-denominator", "path": "/ai/examples/303-rate-numerator-outgrows-denominator.eml.md", "title": "Rate numerator outgrows denominator — the clamp removed the evidence and kept the error", "description": "`rate_numerator_outgrows_denominator.eml` computes a conversion rate three ways — with mismatched populations, with the mismatch clamped to 100%, and with both sides drawn from the same population — and reports how many segments each one gets wrong." }, { "id": "304-rollup-double-counts-shared-parent", "path": "/ai/examples/304-rollup-double-counts-shared-parent.eml.md", "title": "Rollup double counts shared parent — the thing it is walking is not a tree", "description": "`rollup_double_counts_shared_parent.eml` runs the recursive rollup and a set-based rollup that visits each node once, then attributes the gap to specific nodes by counting how many distinct root-to-node paths reach each one." }, { "id": "305-survivor-id-still-referenced", "path": "/ai/examples/305-survivor-id-still-referenced.eml.md", "title": "Survivor id still referenced — the rows vanished from one report and stayed in the other", "description": "`survivor_id_still_referenced.eml` merges two customer records two ways — hard delete, and tombstone with a redirect — then runs two ordinary reports over each result and compares them against the pre-merge totals." }, { "id": "306-abandoned-work-still-lands", "path": "/ai/examples/306-abandoned-work-still-lands.eml.md", "title": "Abandoned work still lands — the caller stopped waiting and the work did not stop working", "description": "`abandoned_work_still_lands.eml` runs six requests through three handlers — deadline only, deadline plus a cancel signal, and deadline plus an idempotency key — and compares what the user was **told** against what the store ends up holding." }, { "id": "307-aggregates-that-do-not-decompose", "path": "/ai/examples/307-aggregates-that-do-not-decompose.eml.md", "title": "Aggregates that do not decompose — four survived partitioning, three did not, and the call sites are identical", "description": "`aggregates_that_do_not_decompose.eml` computes seven aggregates over sixteen values both whole and per-partition, at three partition sizes, and reports which ones agree at every size." }, { "id": "308-attribution-window-picks-the-winner", "path": "/ai/examples/308-attribution-window-picks-the-winner.eml.md", "title": "Attribution window picks the winner — same model, same data, decided by a number in a config file", "description": "`attribution_window_picks_the_winner.eml` holds last-touch attribution fixed and sweeps only the lookback window, reporting per-channel credit, the winner, and how many conversions end up attributed to nobody." }, { "id": "309-batch-boundary-changes-order", "path": "/ai/examples/309-batch-boundary-changes-order.eml.md", "title": "Batch boundary changes order — every batch was handled correctly and the answer was wrong", "description": "`batch_boundary_changes_order.eml` runs the same sort-and-dedup pipeline at seven batch sizes over twelve records and compares each result against the batch-free answer." }, { "id": "310-cancel-is-not-idempotent", "path": "/ai/examples/310-cancel-is-not-idempotent.eml.md", "title": "Cancel is not idempotent — both designs cancel correctly once", "description": "`cancel_is_not_idempotent.eml` applies cancel one, two and three times to the same booking under two designs — cancel-as-delta and cancel-as-target-state — and reads the resulting seats and refunds back out." }, { "id": "311-cancel-lands-between-check-and-act", "path": "/ai/examples/311-cancel-lands-between-check-and-act.eml.md", "title": "Cancel lands between check and act — accepted, recorded, and too early to matter", "description": "`cancel_lands_between_check_and_act.eml` sweeps a cancellation's arrival across every tick of a six-step operation, under three placements of the `if cancelled` check, and counts how many arrival times produce the effect anyway." }, { "id": "312-cancelled-work-still-holds-its-slot", "path": "/ai/examples/312-cancelled-work-still-holds-its-slot.eml.md", "title": "Cancelled work still holds its slot — the pool ran out on a request that was fine", "description": "`cancelled_work_still_holds_its_slot.eml` replays a twelve-request stream through a three-slot pool under two release placements, and reports the pool over time plus which request first gets refused." }, { "id": "313-flush-timer-is-a-debounce", "path": "/ai/examples/313-flush-timer-is-a-debounce.eml.md", "title": "Flush timer is a debounce — the latency guarantee held while the system was idle", "description": "`flush_timer_is_a_debounce.eml` replays three arrival streams through two buffer implementations and reports the worst latency any record actually experienced, against the bound the timer is supposed to provide." }, { "id": "314-last-batch-takes-a-different-path", "path": "/ai/examples/314-last-batch-takes-a-different-path.eml.md", "title": "Last batch takes a different path — the remainder is zero in every fixture", "description": "`last_batch_takes_a_different_path.eml` runs every input length from 0 to 12 through a buffered writer with batch size 4, and checks whether the records that left through the drain path got the same treatment as the rest." }, { "id": "315-last-touch-vs-first-touch", "path": "/ai/examples/315-last-touch-vs-first-touch.eml.md", "title": "Last touch vs first touch — four models, different winners, identical totals", "description": "`last_touch_vs_first_touch.eml` scores four channels under four attribution models over eight conversions, computes each model's ranking, and reports how far channels move." }, { "id": "316-partial-batch-failure-retries-everything", "path": "/ai/examples/316-partial-batch-failure-retries-everything.eml.md", "title": "Partial batch failure retries everything — one record that can never succeed rewrote every record that already had", "description": "`partial_batch_failure_retries_everything.eml` sends six records — one of them permanently bad — through three writers, and counts what the store holds afterwards plus how many records were delivered more than once." }, { "id": "317-rollback-can-fail-too", "path": "/ai/examples/317-rollback-can-fail-too.eml.md", "title": "Rollback can fail too — every state it can stop in is one the system cannot name", "description": "`rollback_can_fail_too.eml` sweeps every cancellation point of a four-step operation against every undo that can refuse, and classifies the resulting state." }, { "id": "318-shared-cause-has-no-unique-split", "path": "/ai/examples/318-shared-cause-has-no-unique-split.eml.md", "title": "Shared cause has no unique split — every factor was necessary, none was sufficient, and the form has one box", "description": "`shared_cause_has_no_unique_split.eml` runs a necessity test on every factor of three incidents — remove it, does the outcome still happen — then applies five allocation rules and reports how often they disagree." }, { "id": "319-two-systems-both-claim-it", "path": "/ai/examples/319-two-systems-both-claim-it.eml.md", "title": "Two systems both claim it — both reports were honest and their sum was not", "description": "`two_systems_both_claim_it.eml` runs two attribution platforms over the same ten conversions, reports each one's internal reconciliation, then compares the naive sum against reality and attributes the excess." }, { "id": "320-usage-reported-as-effect", "path": "/ai/examples/320-usage-reported-as-effect.eml.md", "title": "Usage reported as effect — the metric was largest where the effect was zero", "description": "`usage_reported_as_effect.eml` carries a hidden per-user field saying what each user would have done *without* the feature, computes the reported metric and the true lift side by side, and sweeps the rollout to show which of the two moves." }, { "id": "321-commuting-until-a-third-step-arrives", "path": "/ai/examples/321-commuting-until-a-third-step-arrives.eml.md", "title": "Commuting until a third step arrives — the pair was interchangeable, the pipeline stopped it being a pair", "description": "`commuting_until_a_third_step_arrives.eml` measures whether two steps commute, then measures the same two steps with one more placed between them." }, { "id": "322-coverage-through-one-caller-is-not-coverage", "path": "/ai/examples/322-coverage-through-one-caller-is-not-coverage.eml.md", "title": "Coverage through one caller is not coverage — half the helper has never run", "description": "`coverage_through_one_caller_is_not_coverage.eml` instruments a four-branch helper with a hit counter and runs it from two callers." }, { "id": "323-default-chosen-for-the-first-caller", "path": "/ai/examples/323-default-chosen-for-the-first-caller.eml.md", "title": "The default chosen for the first caller — and the aggregate that hides it", "description": "`default_chosen_for_the_first_caller.eml` runs one `average()` with one empty-input default past two callers for whom that default means opposite things." }, { "id": "324-each-stage-keeps-a-different-invariant", "path": "/ai/examples/324-each-stage-keeps-a-different-invariant.eml.md", "title": "Each stage keeps a different invariant — 3 of 3 checks pass, 1 of 4 invariants survives", "description": "`each_stage_keeps_a_different_invariant.eml` runs three stages that each name and keep one invariant, then evaluates four invariants at every stage boundary." }, { "id": "325-each-stage-verified-nobody-verified-the-seam", "path": "/ai/examples/325-each-stage-verified-nobody-verified-the-seam.eml.md", "title": "Each stage verified, nobody verified the seam — three green checks and 130 units of missing money", "description": "`each_stage_verified_nobody_verified_the_seam.eml` runs a three-stage pipeline over six billing rows, evaluates each stage's own check, and then asks what happened to the money." }, { "id": "326-helper-precondition-only-one-caller-guarantees", "path": "/ai/examples/326-helper-precondition-only-one-caller-guarantees.eml.md", "title": "The precondition only one caller guarantees — a share of 6.0", "description": "`helper_precondition_only_one_caller_guarantees.eml` runs one helper — `max(xs) / sum(xs)` — over two callers' input sets and counts the answers that land outside the range its name implies." }, { "id": "327-idempotence-does-not-compose", "path": "/ai/examples/327-idempotence-does-not-compose.eml.md", "title": "Idempotence does not compose — three retry-safe routines, two retry-unsafe pairs", "description": "`idempotence_does_not_compose.eml` measures `f(f(x)) == f(x)` for three cleanup routines, then measures the same property for every ordered pair built from them." }, { "id": "328-normalisation-makes-the-old-tests-unreachable", "path": "/ai/examples/328-normalisation-makes-the-old-tests-unreachable.eml.md", "title": "Normalisation makes the old tests unreachable — 8 cases, 3 doing work, coverage down", "description": "`normalisation_makes_the_old_tests_unreachable.eml` puts a normaliser in front of a router and measures what happened to the existing test suite." }, { "id": "329-not-found-sentinel-meets-negative-indexing", "path": "/ai/examples/329-not-found-sentinel-meets-negative-indexing.eml.md", "title": "The not-found sentinel meets negative indexing — a miss returns the last row", "description": "`not_found_sentinel_meets_negative_indexing.eml` runs six lookups against a four-row table under a guarded and an unguarded call style." }, { "id": "330-order-decides-which-defect-you-find", "path": "/ai/examples/330-order-decides-which-defect-you-find.eml.md", "title": "Order decides which defect you find — two real bugs, one ticket", "description": "`order_decides_which_defect_you_find.eml` runs seven batches through two validation stages in both orders and counts what gets reported." }, { "id": "331-returns-a-copy-second-caller-assumed-in-place", "path": "/ai/examples/331-returns-a-copy-second-caller-assumed-in-place.eml.md", "title": "Returns a copy, the second caller assumed in place — the call site is identical", "description": "`returns_a_copy_second_caller_assumed_in_place.eml` calls one cleaning helper two ways over the same input and reports what each caller ends up holding." }, { "id": "332-the-pair-reaches-a-state-neither-part-lists", "path": "/ai/examples/332-the-pair-reaches-a-state-neither-part-lists.eml.md", "title": "The pair reaches a state neither part lists — 3 of 3, 3 of 3, and an illegal pair", "description": "`the_pair_reaches_a_state_neither_part_lists.eml` drives two state machines from one event stream, exhaustively over every sequence of length three, and collects the combined states that actually occur." }, { "id": "333-the-safe-range-of-a-composition", "path": "/ai/examples/333-the-safe-range-of-a-composition.eml.md", "title": "The safe range of a composition — neither the union nor the intersection", "description": "`the_safe_range_of_a_composition.eml` sweeps every integer input from 0 to 100 through two functions with documented safe ranges and reads the composition's safe set off the results." }, { "id": "334-upstream-changed-scale-downstream-kept-thresholds", "path": "/ai/examples/334-upstream-changed-scale-downstream-kept-thresholds.eml.md", "title": "Upstream changed scale, downstream kept thresholds — both test suites green, the report worthless", "description": "`upstream_changed_scale_downstream_kept_thresholds.eml` scores twelve inputs on the old scale and the new one, buckets both with the *same unchanged* code, and compares the distributions." }, { "id": "335-upstream-guard-makes-the-downstream-guard-dead", "path": "/ai/examples/335-upstream-guard-makes-the-downstream-guard-dead.eml.md", "title": "The upstream guard makes the downstream guard dead — and the dead one is wrong", "description": "`upstream_guard_makes_the_downstream_guard_dead.eml` runs six orders through two validators in series, then through the second one alone." }, { "id": "336-no-observable-distinguishes-the-two", "path": "/ai/examples/336-no-observable-distinguishes-the-two.eml.md", "title": "No observable distinguishes the two — 1800 observations, zero disagreements", "description": "`no_observable_distinguishes_the_two.eml` runs an aliasing store and a copying store side by side and counts how many observations tell them apart." }, { "id": "337-both-sides-share-the-normaliser", "path": "/ai/examples/337-both-sides-share-the-normaliser.eml.md", "title": "Both sides share the normaliser — 4 behaviours change, the suite sees 0", "description": "`both_sides_share_the_normaliser.eml` runs the same behaviours under two test styles and measures exactly how much sharing a helper costs." }, { "id": "338-over-invalidation-hides-a-broken-cache-key", "path": "/ai/examples/338-over-invalidation-hides-a-broken-cache-key.eml.md", "title": "Over-invalidation hides a broken cache key — and the cache never worked", "description": "`over_invalidation_hides_a_broken_cache_key.eml` sweeps a cache's flush interval and reports when a key that drops a field starts answering." }, { "id": "339-repairing-in-the-wrong-order-loses-data", "path": "/ai/examples/339-repairing-in-the-wrong-order-loses-data.eml.md", "title": "Repairing in the wrong order loses data — a compensating pair cannot be fixed one side at a time", "description": "`repairing_in_the_wrong_order_loses_data.eml` runs four deployment sequences against a writer and a reader that agree on the wrong field name." }, { "id": "340-the-arbiter-asks-one-of-the-parties", "path": "/ai/examples/340-the-arbiter-asks-one-of-the-parties.eml.md", "title": "The arbiter asks one of the parties — A wins 4 of 4, and is right once", "description": "`the_arbiter_asks_one_of_the_parties.eml` resolves disputes between two services three ways and grades each against the event log." }, { "id": "341-the-disagreement-was-resolved-by-widening-the-tolerance", "path": "/ai/examples/341-the-disagreement-was-resolved-by-widening-the-tolerance.eml.md", "title": "The disagreement was resolved by widening the tolerance", "description": "`the_disagreement_was_resolved_by_widening_the_tolerance.eml` sweeps a reconciliation tolerance and measures what it admits besides the difference it was chosen for." }, { "id": "342-the-golden-was-regenerated-by-the-code", "path": "/ai/examples/342-the-golden-was-regenerated-by-the-code.eml.md", "title": "The golden was regenerated by the code — 4 of 4 real changes found, then 0", "description": "`the_golden_was_regenerated_by_the_code.eml` applies a set of changes to a renderer and asks each one twice: does it differ from the frozen golden, and does it differ from a golden regenerated from the changed code." }, { "id": "343-the-independent-check-is-a-translation", "path": "/ai/examples/343-the-independent-check-is-a-translation.eml.md", "title": "The independent check is a translation — measured by where it agrees", "description": "`the_independent_check_is_a_translation.eml` compares three implementations and finds the measurement that separates a second opinion from a transcription." }, { "id": "344-the-majority-is-three-copies", "path": "/ai/examples/344-the-majority-is-three-copies.eml.md", "title": "The majority is three copies — 4 members, 2 opinions", "description": "`the_majority_is_three_copies.eml` puts four implementations to a vote and measures how much evidence the vote actually contains." }, { "id": "345-the-monitor-reads-the-cache-it-monitors", "path": "/ai/examples/345-the-monitor-reads-the-cache-it-monitors.eml.md", "title": "The monitor reads the cache it monitors — 0 of 6 stale ticks caught", "description": "`the_monitor_reads_the_cache_it_monitors.eml` grades three freshness monitors against what was actually served." }, { "id": "346-the-more-precise-answer-wins", "path": "/ai/examples/346-the-more-precise-answer-wins.eml.md", "title": "The more precise answer wins — precision is printed, accuracy is not", "description": "`the_more_precise_answer_wins.eml` puts a four-decimal estimate and a whole-number estimate against a computed truth." }, { "id": "347-the-noisiest-check-is-relaxed-first", "path": "/ai/examples/347-the-noisiest-check-is-relaxed-first.eml.md", "title": "The noisiest check is relaxed first — 7 of 7 defects caught, then 4", "description": "`the_noisiest_check_is_relaxed_first.eml` runs a threshold-tuning policy for several rounds and measures what the suite can still catch after each one." }, { "id": "348-the-safety-net-is-load-bearing", "path": "/ai/examples/348-the-safety-net-is-load-bearing.eml.md", "title": "The safety net is load-bearing — and it is the only correct code in the pipeline", "description": "`the_safety_net_is_load_bearing.eml` measures what fraction of a pipeline's correct output arrives through the reconciliation pass rather than through the path that is supposed to produce it." }, { "id": "349-two-defects-cancel-in-the-round-trip", "path": "/ai/examples/349-two-defects-cancel-in-the-round-trip.eml.md", "title": "Two defects cancel in the round trip — and half a fix is worse than none", "description": "`two_defects_cancel_in_the_round_trip.eml` runs an encoder and a decoder that are both wrong, through the only test either of them has." }, { "id": "350-two-off-by-ones-preserve-the-count", "path": "/ai/examples/350-two-off-by-ones-preserve-the-count.eml.md", "title": "Two off-by-ones preserve the count — so the length check goes quiet", "description": "`two_off_by_ones_preserve_the_count.eml` slides a window whose start is one late and whose end is one late, and reports what a length check can see." }, { "id": "351-validated-on-records-that-already-passed", "path": "/ai/examples/351-validated-on-records-that-already-passed.eml.md", "title": "Validated on records that already passed — a clean run over real production data", "description": "`validated_on_records_that_already_passed.eml` runs a validator over the store it produced, and over the submissions that store came from." }, { "id": "352-one-fact-counted-as-three-sources", "path": "/ai/examples/352-one-fact-counted-as-three-sources.eml.md", "title": "One fact counted as three sources — 4 systems agree, 2 origins exist", "description": "`one_fact_counted_as_three_sources.eml` traces each system's answer back to where it came from and counts distinct origins rather than distinct systems." }, { "id": "353-the-exception-outlived-its-reason", "path": "/ai/examples/353-the-exception-outlived-its-reason.eml.md", "title": "The exception outlived its reason — 5 of 6 rows removed for a condition that is false", "description": "`the_exception_outlived_its_reason.eml` evaluates the stated reason for an exclusion against the rows the exclusion currently removes." }, { "id": "354-the-record-says-what-was-decided", "path": "/ai/examples/354-the-record-says-what-was-decided.eml.md", "title": "The record says what was decided — 6 of 6 answered, 0 of 6 checkable", "description": "`the_record_says_what_was_decided.eml` tries to re-derive every decision from each of two records and counts how many it can reach." }, { "id": "355-the-rerun-seeds-from-the-last-run", "path": "/ai/examples/355-the-rerun-seeds-from-the-last-run.eml.md", "title": "The rerun seeds from the last run — and the measurement refused the premise", "description": "`the_rerun_seeds_from_the_last_run.eml` runs a warm-started and a cold-started chain over the same daily data, with the same pass cap so the seed is the only difference." }, { "id": "356-the-resolution-is-cited-in-the-next-dispute", "path": "/ai/examples/356-the-resolution-is-cited-in-the-next-dispute.eml.md", "title": "The resolution is cited in the next dispute — 5 decisions, 1 observation", "description": "`the_resolution_is_cited_in_the_next_dispute.eml` runs the same disputes under two policies and counts how often each one actually looked at evidence." }, { "id": "357-both-parties-assumed-the-other-checked-it", "path": "/ai/examples/357-both-parties-assumed-the-other-checked-it.eml.md", "title": "Both parties assumed the other checked it — 3 unchecked, all 3 seams", "description": "`both_parties_assumed_the_other_checked_it.eml` offers every item to both parties' ownership rules and computes the four regions." }, { "id": "358-closed-because-it-stopped-being-reported", "path": "/ai/examples/358-closed-because-it-stopped-being-reported.eml.md", "title": "Closed because it stopped being reported — 485 occurrences after closure, 0 reports", "description": "`closed_because_it_stopped_being_reported.eml` evaluates a \"no reports for three periods\" closure rule against what the defect was actually doing." }, { "id": "359-filed-against-where-it-surfaced", "path": "/ai/examples/359-filed-against-where-it-surfaced.eml.md", "title": "Filed against where it surfaced — 1 site named, 4 affected", "description": "`filed_against_where_it_surfaced.eml` applies two fixes to the same pipeline — one at the reported location, one at the source — and measures every consumer." }, { "id": "360-finding-outruns-fixing", "path": "/ai/examples/360-finding-outruns-fixing.eml.md", "title": "Finding outruns fixing — same capacity, same count fixed, 127 against 71", "description": "`finding_outruns_fixing.eml` simulates a defect queue under two work orders with identical throughput." }, { "id": "361-one-report-two-mechanisms", "path": "/ai/examples/361-one-report-two-mechanisms.eml.md", "title": "One report, two mechanisms — 3 items named, 7 wrong, 2 causes", "description": "`one_report_two_mechanisms.eml` takes an honest, well-evidenced defect report and measures what its *shape* does to the fix." }, { "id": "362-severity-assigned-before-scope-was-measured", "path": "/ai/examples/362-severity-assigned-before-scope-was-measured.eml.md", "title": "Severity assigned before scope was measured — 0 inversions, then 1", "description": "`severity_assigned_before_scope_was_measured.eml` runs the same three findings over two populations and counts how often triage-by-witness ranks them wrongly." }, { "id": "363-the-checker-inherits-the-builders-vocabulary", "path": "/ai/examples/363-the-checker-inherits-the-builders-vocabulary.eml.md", "title": "The checker inherits the builder's vocabulary — 6 of 6 named, 0 of 6 unnamed", "description": "`the_checker_inherits_the_builders_vocabulary.eml` measures a doc-led search's recall, split by whether the defect's class has a name in the docs." }, { "id": "364-the-fix-moved-the-boundary", "path": "/ai/examples/364-the-fix-moved-the-boundary.eml.md", "title": "The fix moved the boundary — 0 disagreements on every integer tested", "description": "`the_fix_moved_the_boundary.eml` runs two repairs for the same boundary defect over two domains and measures where they come apart." }, { "id": "365-the-guard-stopped-being-able-to-fail", "path": "/ai/examples/365-the-guard-stopped-being-able-to-fail.eml.md", "title": "The guard stopped being able to fail — same green, 1 guard alive, then 0", "description": "`the_guard_stopped_being_able_to_fail.eml` drills every test in a suite by breaking the code it guards and re-running it." }, { "id": "366-the-handoff-loses-what-has-no-field", "path": "/ai/examples/366-the-handoff-loses-what-has-no-field.eml.md", "title": "The handoff loses what has no field — 4 of 6 decidable, and one new field bought 0", "description": "`the_handoff_loses_what_has_no_field.eml` runs each of the receiver's decisions twice: from the transmitted subset, and from everything the sender knew." }, { "id": "367-the-regression-test-locks-in-the-workaround", "path": "/ai/examples/367-the-regression-test-locks-in-the-workaround.eml.md", "title": "The regression test locks in the workaround — green in the 2 states where the system is wrong", "description": "`the_regression_test_locks_in_the_workaround.eml` classifies every assertion in a suite against the rule it was supposed to protect." }, { "id": "368-the-repro-succeeds-for-another-reason", "path": "/ai/examples/368-the-repro-succeeds-for-another-reason.eml.md", "title": "The repro succeeds for another reason — 140 with the defect on, 140 with it off", "description": "`the_repro_succeeds_for_another_reason.eml` measures whether a reproduction script is sensitive to the defect it was filed against." }, { "id": "369-the-second-party-finds-a-different-class", "path": "/ai/examples/369-the-second-party-finds-a-different-class.eml.md", "title": "The second party finds a different class — 5 found against 7, and 1 that mattered", "description": "`the_second_party_finds_a_different_class.eml` runs two searchers over one defect population and computes every region of the overlap." }, { "id": "370-the-verifier-reran-the-fixers-script", "path": "/ai/examples/370-the-verifier-reran-the-fixers-script.eml.md", "title": "The verifier reran the fixer's script — 0 escapes, and 9 inputs never seen", "description": "`the_verifier_reran_the_fixers_script.eml` runs three input sets against the same repair and counts what each can find." }, { "id": "371-two-findings-one-defect", "path": "/ai/examples/371-two-findings-one-defect.eml.md", "title": "Two findings, one defect — 2 causes each, 1 in the intersection", "description": "`two_findings_one_defect.eml` measures what routing two reports to two owners destroys." }, { "id": "372-bucketed-by-when-it-arrived", "path": "/ai/examples/372-bucketed-by-when-it-arrived.eml.md", "title": "Bucketed by when it arrived — the totals reconcile and the shape does not", "description": "`bucketed_by_when_it_arrived.eml` builds a daily series two ways from the same 18 events." }, { "id": "373-each-step-is-of-those-who-reached-it", "path": "/ai/examples/373-each-step-is-of-those-who-reached-it.eml.md", "title": "Each step is of those who reached it — five 90% steps make 59%, and fixing any one gains the same", "description": "`each_step_is_of_those_who_reached_it.eml` computes the end-to-end rate and the per-step losses from the same five rates, then tries improving each step in turn." }, { "id": "374-passed-means-did-not-raise", "path": "/ai/examples/374-passed-means-did-not-raise.eml.md", "title": "Passed means did not raise — perfect on 2 of 4, blind on the other 2", "description": "`passed_means_did_not_raise.eml` runs four broken variants of the same function through a smoke test and a value test." }, { "id": "375-the-absence-was-created-by-the-filter", "path": "/ai/examples/375-the-absence-was-created-by-the-filter.eml.md", "title": "The absence was created by the filter — same loss, one keeps the answer", "description": "`the_absence_was_created_by_the_filter.eml` runs two pipelines with comparable drop rates over the same 40 records and compares each reported rate against the true one." }, { "id": "376-the-caveat-does-not-survive-the-second-hop", "path": "/ai/examples/376-the-caveat-does-not-survive-the-second-hop.eml.md", "title": "The caveat does not survive the second hop — 3 of 3 qualifiers gone, number unchanged", "description": "`the_caveat_does_not_survive_the_second_hop.eml` walks one payload through four consumers and asks what is left at each." }, { "id": "377-the-clarification-arrives-after-the-decision", "path": "/ai/examples/377-the-clarification-arrives-after-the-decision.eml.md", "title": "The clarification arrives after the decision — 3 wrong reviews, and waiting 3 days fixes all of them", "description": "`the_clarification_arrives_after_the_decision.eml` replays every decision at its own time and again with everything that eventually arrived." }, { "id": "378-the-counterexample-outside-the-generator", "path": "/ai/examples/378-the-counterexample-outside-the-generator.eml.md", "title": "The counterexample outside the generator — 2000 inputs found 0, 160 found 52", "description": "`the_counterexample_outside_the_generator.eml` checks two real implementations of integer division against each other and varies the sample count and the sample range separately." }, { "id": "379-the-id-answers-which-record-not-which-person", "path": "/ai/examples/379-the-id-answers-which-record-not-which-person.eml.md", "title": "The id answers which record, not which person — 10 accounts, 6 people", "description": "`the_id_answers_which_record_not_which_person.eml` counts new signups two ways from the same rows." }, { "id": "380-the-qualifier-changes-the-number", "path": "/ai/examples/380-the-qualifier-changes-the-number.eml.md", "title": "The qualifier changes the number — a 40-point drop and zero change in the service", "description": "`the_qualifier_changes_the_number.eml` computes the same uptime figure from one log under a loose rule and a stated one." }, { "id": "381-the-search-that-stopped-early", "path": "/ai/examples/381-the-search-that-stopped-early.eml.md", "title": "The search that stopped early — 7 of 11 records never examined, report unchanged", "description": "`the_search_that_stopped_early.eml` runs the same scanner over a stream it was written for and a stream that outgrew it." }, { "id": "382-the-shared-rule-ranked-worst", "path": "/ai/examples/382-the-shared-rule-ranked-worst.eml.md", "title": "The shared rule ranked worst — 0 of 3 against the strict rule, where three different rules got 2 of 3", "description": "`the_shared_rule_ranked_worst.eml` ranks three teams three ways from one ticket log and compares each ranking with a strict rule applied to everybody." }, { "id": "383-the-test-asserts-the-format-not-the-value", "path": "/ai/examples/383-the-test-asserts-the-format-not-the-value.eml.md", "title": "The test asserts the format, not the value — 5 false alarms and 2 blind pairs", "description": "`the_test_asserts_the_format_not_the_value.eml` measures the two failure directions of a rendered-output assertion separately, on the same function at the same time." }, { "id": "384-two-definitions-one-column-name", "path": "/ai/examples/384-two-definitions-one-column-name.eml.md", "title": "Two definitions, one column name — the roll-up says 11 and only 10 people exist", "description": "`two_definitions_one_column_name.eml` derives both teams' numbers and the true pooled numbers from one event log." }, { "id": "385-two-sweeps-one-sentence", "path": "/ai/examples/385-two-sweeps-one-sentence.eml.md", "title": "Two sweeps, one sentence — 132 of 144 worlds hide behind the same zero", "description": "`two_sweeps_one_sentence.eml` runs every one-defect world through both sweeps and counts which worlds each one can separate from the clean world." }, { "id": "386-zero-rows-three-explanations", "path": "/ai/examples/386-zero-rows-three-explanations.eml.md", "title": "Zero rows, three explanations — 1 of 3 worlds separable, and two probes fix it", "description": "`zero_rows_three_explanations.eml` runs three worlds through the same query and counts how many of them each set of observations can still tell apart." }, { "id": "387-everyone-was-treated-so-there-is-no-before", "path": "/ai/examples/387-everyone-was-treated-so-there-is-no-before.eml.md", "title": "Everyone was treated, so there is no before - the mix shift hid 2.3 points of a 4.0 effect", "description": "`everyone_was_treated_so_there_is_no_before.eml` rebuilds month 3 from month 2's mix and month 2 from month 3's, so each cause can be measured separately." }, { "id": "388-fixing-the-flagged-ones-moved-the-threshold", "path": "/ai/examples/388-fixing-the-flagged-ones-moved-the-threshold.eml.md", "title": "Fixing the flagged ones moved the threshold - 3 flagged every round, forever", "description": "`fixing_the_flagged_ones_moved_the_threshold.eml` runs a relative and an absolute review rule over the same starting population for the same number of rounds." }, { "id": "389-not-deciding-had-a-cost-and-no-owner", "path": "/ai/examples/389-not-deciding-had-a-cost-and-no-owner.eml.md", "title": "Not deciding had a cost and no owner - waiting overtakes being wrong at week 17", "description": "`not_deciding_had_a_cost_and_no_owner.eml` computes both costs on the same scale, week by week, so the comparison nobody makes is available to make." }, { "id": "390-ranked-by-clicks-then-shown-first", "path": "/ai/examples/390-ranked-by-clicks-then-shown-first.eml.md", "title": "Ranked by clicks, then shown first - locks in at 66% and never reaches 100%", "description": "`ranked_by_clicks_then_shown_first.eml` runs the ranker for five days over items whose quality is fixed, known to the program, and never read by the ranker." }, { "id": "391-the-analysis-ran-until-it-agreed", "path": "/ai/examples/391-the-analysis-ran-until-it-agreed.eml.md", "title": "The analysis ran until it agreed - 4 of 10 segments up, in data with an effect of exactly zero", "description": "`the_analysis_ran_until_it_agreed.eml` cuts a flat overall result by segment and counts how many segments have to be tried before one is up." }, { "id": "392-the-decision-was-made-before-the-number-arrived", "path": "/ai/examples/392-the-decision-was-made-before-the-number-arrived.eml.md", "title": "The decision was made before the number arrived - 1 distinct decision across 8 possible results, 4 distinct announcements", "description": "`the_decision_was_made_before_the_number_arrived.eml` runs the decision over every possible result and counts the distinct decisions, because that - not whether it was read - is the test of whether an analysis mattered." }, { "id": "393-the-forecast-triggered-its-own-refutation", "path": "/ai/examples/393-the-forecast-triggered-its-own-refutation.eml.md", "title": "The forecast triggered its own refutation - 100% of the filed error was created by acting on it", "description": "`the_forecast_triggered_its_own_refutation.eml` computes the observed world, the world the forecast was about, and next year's correction." }, { "id": "394-the-holdout-denied-a-real-benefit", "path": "/ai/examples/394-the-holdout-denied-a-real-benefit.eml.md", "title": "The holdout denied a real benefit - 320 in the good world, 2200 saved in the bad one", "description": "`the_holdout_denied_a_real_benefit.eml` runs both worlds to completion and prints them side by side. No probability is assumed anywhere." }, { "id": "395-the-holdout-is-the-only-thing-that-can-say-no", "path": "/ai/examples/395-the-holdout-is-the-only-thing-that-can-say-no.eml.md", "title": "The holdout is the only thing that can say no - 12.0 without it, 0.0 with it", "description": "`the_holdout_is_the_only_thing_that_can_say_no.eml` runs two worlds through the same arithmetic: one where the change does nothing, and one where it works." }, { "id": "396-the-holdout-shrank-until-it-could-not-decide", "path": "/ai/examples/396-the-holdout-shrank-until-it-could-not-decide.eml.md", "title": "The holdout shrank until it could not decide - and at an effect of 6 it still could", "description": "`the_holdout_shrank_until_it_could_not_decide.eml` enumerates every possible contiguous holdout of each size - nothing is sampled - and prints the range of measured effects." }, { "id": "397-the-holdout-was-not-held-out", "path": "/ai/examples/397-the-holdout-was-not-held-out.eml.md", "title": "The holdout was not held out - 50% of the effect recovered, and still the right shape", "description": "`the_holdout_was_not_held_out.eml` counts which control requests share a cache key with treated traffic, then measures the effect with and without that leak." }, { "id": "398-the-second-metric-was-consulted-because-the-first-said-no", "path": "/ai/examples/398-the-second-metric-was-consulted-because-the-first-said-no.eml.md", "title": "The second metric was consulted because the first said no - 7 of 8 launches have something to report, with no effect anywhere", "description": "`the_second_metric_was_consulted_because_the_first_said_no.eml` runs eight hypothetical launches in which the true effect is zero on every metric, and counts how often each rule finds something." }, { "id": "399-the-target-stopped-being-a-measure", "path": "/ai/examples/399-the-target-stopped-being-a-measure.eml.md", "title": "The target stopped being a measure - 100% concordance before, no decidable pairs after", "description": "`the_target_stopped_being_a_measure.eml` computes the proxy and the goal from the same ticket log in both periods, and measures how well the proxy can still rank tickets by the goal." }, { "id": "400-the-threshold-was-set-after-seeing-the-result", "path": "/ai/examples/400-the-threshold-was-set-after-seeing-the-result.eml.md", "title": "The threshold was set after seeing the result - excludes 3 of 10 where a fixed bar excluded 6", "description": "`the_threshold_was_set_after_seeing_the_result.eml` enumerates every bar anyone in the room could have defended and asks what the rule can still exclude once the choice is made afterwards." }, { "id": "401-the-work-moved-to-where-nobody-measures", "path": "/ai/examples/401-the-work-moved-to-where-nobody-measures.eml.md", "title": "The work moved to where nobody measures - chart says 66% better, system is 9 worse", "description": "`the_work_moved_to_where_nobody_measures.eml` runs the same job list under both routings, so the comparison is between two policies rather than two measurements." }, { "id": "402-filed-under-the-first-category-that-matched", "path": "/ai/examples/402-filed-under-the-first-category-that-matched.eml.md", "title": "Filed under the first category that matched - every count ranges from 1 to 6 on rule order alone", "description": "`filed_under_the_first_category_that_matched.eml` runs the same items under all six orderings of the same three rules." }, { "id": "403-nobody-opened-a-single-one", "path": "/ai/examples/403-nobody-opened-a-single-one.eml.md", "title": "Nobody opened a single one - 2 records show what the summary has no column for", "description": "`nobody_opened_a_single_one.eml` computes the summary and a small sample from the same rows, and checks whether the extra field is redundant with the categories rather than assuming it." }, { "id": "404-other-became-the-largest-category", "path": "/ai/examples/404-other-became-the-largest-category.eml.md", "title": "Other became the largest category - and every item in it was filed correctly", "description": "`other_became_the_largest_category.eml` classifies both eras by the same scheme, so the growth of the catch-all is a fact about the arriving population rather than about drift." }, { "id": "405-renaming-the-category-changed-the-trend", "path": "/ai/examples/405-renaming-the-category-changed-the-trend.eml.md", "title": "Renaming the category changed the trend - a 50% drop that is entirely definitional", "description": "`renaming_the_category_changed_the_trend.eml` counts every month under both rules, so the definitional part of the step separates from the real part." }, { "id": "406-the-action-items-were-closed-not-done", "path": "/ai/examples/406-the-action-items-were-closed-not-done.eml.md", "title": "The action items were closed, not done - 6 of 6 closed, 1 of them blocks anything", "description": "`the_action_items_were_closed_not_done.eml` replays the incident step by step against the post-fix system, because \"was the work done\" and \"would this happen again\" are answered by different evidence." }, { "id": "407-the-average-describes-no-one", "path": "/ai/examples/407-the-average-describes-no-one.eml.md", "title": "The average describes no one - 0 customers within any tolerance of both means", "description": "`the_average_describes_no_one.eml` counts how many records sit near the mean on both dimensions at four tolerances, and computes the median on the same data." }, { "id": "408-the-count-is-of-tickets-not-of-incidents", "path": "/ai/examples/408-the-count-is-of-tickets-not-of-incidents.eml.md", "title": "The count is of tickets, not of incidents - reports fell 54% and events did not move", "description": "`the_count_is_of_tickets_not_of_incidents.eml` builds both quarters from the same underlying events so the two counts can be separated." }, { "id": "409-the-fix-from-last-time-was-in-place", "path": "/ai/examples/409-the-fix-from-last-time-was-in-place.eml.md", "title": "The fix from last time was in place - 1 of 5 paths closed, and 4 incidents still to come", "description": "`the_fix_from_last_time_was_in_place.eml` runs every path to the outage against every guard, so \"would the existing fix have stopped this\" is answered by enumeration rather than by memory." }, { "id": "410-the-lesson-was-filed-where-nobody-looks", "path": "/ai/examples/410-the-lesson-was-filed-where-nobody-looks.eml.md", "title": "The lesson was filed where nobody looks - 3 of 7 places reach the person who needs it", "description": "`the_lesson_was_filed_where_nobody_looks.eml` scores each place a lesson can live by the same three properties and computes the reach rather than arguing it." }, { "id": "411-the-outlier-was-removed-for-being-one", "path": "/ai/examples/411-the-outlier-was-removed-for-being-one.eml.md", "title": "The outlier was removed for being one - 0 instances of the investigated thing survive cleaning", "description": "`the_outlier_was_removed_for_being_one.eml` computes the statistics with and without the cleaning rule and counts how many genuine slow paths each dataset still contains." }, { "id": "412-the-rule-outlived-its-reason", "path": "/ai/examples/412-the-rule-outlived-its-reason.eml.md", "title": "The rule outlived its reason - 6 rejections and 0 downstream failures, in both eras", "description": "`the_rule_outlived_its_reason.eml` runs the same rule against both eras so that \"what did it catch\" is answered per era rather than in aggregate." }, { "id": "413-the-second-time-was-faster-and-that-is-all", "path": "/ai/examples/413-the-second-time-was-faster-and-that-is-all.eml.md", "title": "The second time was faster, and that is all - MTTR down 56%, hours down unchanged to the hour", "description": "`the_second_time_was_faster_and_that_is_all.eml` computes both quantities from the same incident list so the two kinds of progress can be told apart." }, { "id": "414-the-top-three-are-the-same-item", "path": "/ai/examples/414-the-top-three-are-the-same-item.eml.md", "title": "The top three are the same item - one cause spread across three strings outranks every entry", "description": "`the_top_three_are_the_same_item.eml` groups by the string the log carries and again by the cause the strings stand for." }, { "id": "415-the-total-is-right-and-every-line-is-wrong", "path": "/ai/examples/415-the-total-is-right-and-every-line-is-wrong.eml.md", "title": "The total is right and every line is wrong - net error zero, six lines off", "description": "`the_total_is_right_and_every_line_is_wrong.eml` compares each line against its true value and sums the errors, alongside the reconciliation that is actually run." }, { "id": "416-two-taxonomies-that-do-not-partition", "path": "/ai/examples/416-two-taxonomies-that-do-not-partition.eml.md", "title": "Two taxonomies that do not partition - both totals are 12 and their numbers cannot be added", "description": "`two_taxonomies_that_do_not_partition.eml` labels every defect under both schemes, so what each can and cannot say about one population is measured rather than argued." }, { "id": "417-dividing-in-place-changes-the-type", "path": "/ai/examples/417-dividing-in-place-changes-the-type.eml.md", "title": "Dividing in place changes the type", "description": "`dividing_in_place_changes_the_type.eml` - Four compound assignments look alike. One of them changes what the variable is." }, { "id": "418-nobody-calls-the-documented-endpoint", "path": "/ai/examples/418-nobody-calls-the-documented-endpoint.eml.md", "title": "Nobody calls the documented endpoint", "description": "`nobody_calls_the_documented_endpoint.eml` - The documented endpoint carries 3% of the traffic. The one nobody wrote down carries most of it." }, { "id": "419-one-counterexample-retired-a-rule", "path": "/ai/examples/419-one-counterexample-retired-a-rule.eml.md", "title": "One counterexample retired a rule", "description": "`one_counterexample_retired_a_rule.eml` - A rule was removed after its visible failures. How often each policy is right is computed below; no figure is stated here, because a number in a comment is checked by nothing." }, { "id": "420-one-customer-set-the-roadmap", "path": "/ai/examples/420-one-customer-set-the-roadmap.eml.md", "title": "One customer set the roadmap", "description": "`one_customer_set_the_roadmap.eml` - One account is 4% of revenue and most of the roadmap." }, { "id": "421-the-defect-was-load-bearing", "path": "/ai/examples/421-the-defect-was-load-bearing.eml.md", "title": "The defect was load bearing", "description": "`the_defect_was_load_bearing.eml` - The bug was fixed and more callers broke than were ever helped." }, { "id": "422-the-demo-case-became-the-only-tested-path", "path": "/ai/examples/422-the-demo-case-became-the-only-tested-path.eml.md", "title": "The demo case became the only tested path", "description": "`the_demo_case_became_the_only_tested_path.eml` - The example in the README is one shape of input. It is the shape 14 of 18 tests exercise." }, { "id": "423-the-deprecation-reached-the-readers", "path": "/ai/examples/423-the-deprecation-reached-the-readers.eml.md", "title": "The deprecation reached the readers", "description": "`the_deprecation_reached_the_readers.eml` - The deprecation was announced in every channel the team has. How many callers that reached is computed below; stating it here would be a number nothing checks." }, { "id": "424-the-error-metric-has-no-sign", "path": "/ai/examples/424-the-error-metric-has-no-sign.eml.md", "title": "The error metric has no sign", "description": "`the_error_metric_has_no_sign.eml` - Two forecasting models are scored by absolute error. The score ranks them equal. They are not the same model." }, { "id": "425-the-error-text-is-parsed-downstream", "path": "/ai/examples/425-the-error-text-is-parsed-downstream.eml.md", "title": "The error text is parsed downstream", "description": "`the_error_text_is_parsed_downstream.eml` - The error message was reworded to be clearer. Four consumers were matching on the old wording." }, { "id": "426-the-guard-clause-skipped-the-accounting", "path": "/ai/examples/426-the-guard-clause-skipped-the-accounting.eml.md", "title": "The guard clause skipped the accounting", "description": "`the_guard_clause_skipped_the_accounting.eml` - A guard clause was added at the top of a loop. It skipped more than the record it was aimed at." }, { "id": "427-the-incident-everyone-remembers", "path": "/ai/examples/427-the-incident-everyone-remembers.eml.md", "title": "The incident everyone remembers", "description": "`the_incident_everyone_remembers.eml` - The outage nobody will forget cost less than the class nobody can name." }, { "id": "428-the-last-point-is-the-whole-trend", "path": "/ai/examples/428-the-last-point-is-the-whole-trend.eml.md", "title": "The last point is the whole trend", "description": "`the_last_point_is_the_whole_trend.eml` - The last month is down. The year is up. Both are read off the same twelve numbers." }, { "id": "429-the-range-and-the-slice-disagree-about-the-end", "path": "/ai/examples/429-the-range-and-the-slice-disagree-about-the-end.eml.md", "title": "The range and the slice disagree about the end", "description": "`the_range_and_the_slice_disagree_about_the_end.eml` - Two constructs in one language, both written [a:b], and they do not mean the same b." }, { "id": "430-the-reading-and-the-number-are-not-the-same-record", "path": "/ai/examples/430-the-reading-and-the-number-are-not-the-same-record.eml.md", "title": "The reading and the number are not the same record", "description": "`the_reading_and_the_number_are_not_the_same_record.eml` - The log stores readings as text. The report parses them with `float()`. One of those two holds a fact the other cannot." }, { "id": "431-the-unspecified-order-became-the-contract", "path": "/ai/examples/431-the-unspecified-order-became-the-contract.eml.md", "title": "The unspecified order became the contract", "description": "`the_unspecified_order_became_the_contract.eml` - The documentation says the order is unspecified. Seven of nine callers depend on it." }, { "id": "432-each-team-minimised-its-own-cost", "path": "/ai/examples/432-each-team-minimised-its-own-cost.eml.md", "title": "Each team minimised its own cost", "description": "`each_team_minimised_its_own_cost.eml` - Four teams, four correct decisions, one total. Whether the total is the smallest available is computed below." }, { "id": "433-muting-the-alert-removed-the-only-evidence", "path": "/ai/examples/433-muting-the-alert-removed-the-only-evidence.eml.md", "title": "Muting the alert removed the only evidence", "description": "`muting_the_alert_removed_the_only_evidence.eml` - Two alerts were muted in the same week. Their histories since are identical. Only one of the two conditions stopped." }, { "id": "434-nobody-can-prove-any-of-them-is-removable", "path": "/ai/examples/434-nobody-can-prove-any-of-them-is-removable.eml.md", "title": "Nobody can prove any of them is removable", "description": "`nobody_can_prove_any_of_them_is_removable.eml` - Eleven workarounds, each added for a condition that was real. How many can be shown to be dead is computed below, and it is not the same as how many are dead." }, { "id": "435-one-flag-per-incident-and-no-tested-combination", "path": "/ai/examples/435-one-flag-per-incident-and-no-tested-combination.eml.md", "title": "One flag per incident and no tested combination", "description": "`one_flag_per_incident_and_no_tested_combination.eml` - Twelve flags, one per incident, each added by someone who was right. How many live combinations were ever tested is computed below." }, { "id": "436-the-available-response-was-to-add-a-person", "path": "/ai/examples/436-the-available-response-was-to-add-a-person.eml.md", "title": "The available response was to add a person", "description": "`the_available_response_was_to_add_a_person.eml` - The system cannot be changed this quarter, so a person checks the output. What that catches is computed below." }, { "id": "437-the-exception-was-caught-where-it-could-be-caught", "path": "/ai/examples/437-the-exception-was-caught-where-it-could-be-caught.eml.md", "title": "The exception was caught where it could be caught", "description": "`the_exception_was_caught_where_it_could_be_caught.eml` - The handler sits at the top of the request, because that is the function this team owns. How many of the failures it catches it can answer correctly is computed below." }, { "id": "438-the-fix-was-applied-to-the-input-instead", "path": "/ai/examples/438-the-fix-was-applied-to-the-input-instead.eml.md", "title": "The fix was applied to the input instead", "description": "`the_fix_was_applied_to_the_input_instead.eml` - The consumer belongs to another team, so the input is cleaned before it gets there. What that covers is computed below." }, { "id": "439-the-log-covers-the-paths-we-suspected", "path": "/ai/examples/439-the-log-covers-the-paths-we-suspected.eml.md", "title": "The log covers the paths we suspected", "description": "`the_log_covers_the_paths_we_suspected.eml` - Logging was added to the paths that had failed before. The logs now say those paths are where the failures are." }, { "id": "440-the-oldest-one-is-the-one-nobody-questions", "path": "/ai/examples/440-the-oldest-one-is-the-one-nobody-questions.eml.md", "title": "The oldest one is the one nobody questions", "description": "`the_oldest_one_is_the_one_nobody_questions.eml` - The older a workaround is, the more likely its condition is gone and the less likely anyone looks at it. Both halves are computed below." }, { "id": "441-the-rate-is-visible-and-the-request-is-not", "path": "/ai/examples/441-the-rate-is-visible-and-the-request-is-not.eml.md", "title": "The rate is visible and the request is not", "description": "`the_rate_is_visible_and_the_request_is_not.eml` - The error rate is on the dashboard, correct to a tenth of a percent, and updated every minute. How many customer complaints it can resolve is computed below." }, { "id": "442-the-restart-works-so-the-fix-never-pays", "path": "/ai/examples/442-the-restart-works-so-the-fix-never-pays.eml.md", "title": "The restart works so the fix never pays", "description": "`the_restart_works_so_the_fix_never_pays.eml` - The process leaks and gets restarted. Whether fixing it pays is computed below rather than assumed either way." }, { "id": "443-the-runbook-grew-one-step-per-incident", "path": "/ai/examples/443-the-runbook-grew-one-step-per-incident.eml.md", "title": "The runbook grew one step per incident", "description": "`the_runbook_grew_one_step_per_incident.eml` - Fourteen steps, one per incident. How many of them the next incident needs is computed below." }, { "id": "444-the-team-that-can-see-it-cannot-change-it", "path": "/ai/examples/444-the-team-that-can-see-it-cannot-change-it.eml.md", "title": "The team that can see it cannot change it", "description": "`the_team_that_can_see_it_cannot_change_it.eml` - The platform team can see every one of these findings. How many of them anyone can act on is computed below." }, { "id": "445-the-timeout-was-raised-because-it-was-the-adjustable-number", "path": "/ai/examples/445-the-timeout-was-raised-because-it-was-the-adjustable-number.eml.md", "title": "The timeout was raised because it was the adjustable number", "description": "`the_timeout_was_raised_because_it_was_the_adjustable_number.eml` - The dependency got slower. The timeout was raised. How many calls that changed is computed below." }, { "id": "446-the-warning-fires-where-the-caller-cannot-hear-it", "path": "/ai/examples/446-the-warning-fires-where-the-caller-cannot-hear-it.eml.md", "title": "The warning fires where the caller cannot hear it", "description": "`the_warning_fires_where_the_caller_cannot_hear_it.eml` - The deprecation warning was moved into the call itself, which is the right place for it. How many callers can act on it is computed below." }, { "id": "447-both-sides-buffered-against-the-other", "path": "/ai/examples/447-both-sides-buffered-against-the-other.eml.md", "title": "Both sides buffered against the other", "description": "`both_sides_buffered_against_the_other.eml` - Each side added a queue against the other's variability. What the pair does to the time a unit of work spends in the system is simulated rather than assumed." }, { "id": "448-each-number-moves-the-other-so-the-slope-is-neither", "path": "/ai/examples/448-each-number-moves-the-other-so-the-slope-is-neither.eml.md", "title": "Each number moves the other so the slope is neither", "description": "`each_number_moves_the_other_so_the_slope_is_neither.eml` - Test count and build time move together across twelve weeks. What the slope between them measures is computed below." }, { "id": "449-each-side-added-a-shim-for-the-other", "path": "/ai/examples/449-each-side-added-a-shim-for-the-other.eml.md", "title": "Each side added a shim for the other", "description": "`each_side_added_a_shim_for_the_other.eml` - Each team wrote a compatibility layer for the other team's changes. How many of them handle the same incompatibility is computed below." }, { "id": "450-every-rollback-made-the-next-deploy-bigger", "path": "/ai/examples/450-every-rollback-made-the-next-deploy-bigger.eml.md", "title": "Every rollback made the next deploy bigger", "description": "`every_rollback_made_the_next_deploy_bigger.eml` - A bad deploy is followed by more review before the next one. What that does to the next deploy is simulated rather than argued." }, { "id": "451-neither-date-was-set-by-the-work", "path": "/ai/examples/451-neither-date-was-set-by-the-work.eml.md", "title": "Neither date was set by the work", "description": "`neither_date_was_set_by_the_work.eml` - Each team set its date from the other team's date. Where either date came from is computed below." }, { "id": "452-one-interval-cannot-see-which-way-it-feeds-back", "path": "/ai/examples/452-one-interval-cannot-see-which-way-it-feeds-back.eml.md", "title": "One interval cannot see which way it feeds back", "description": "`one_interval_cannot_see_which_way_it_feeds_back.eml` - Two systems take the same shock and respond identically in the first interval. Which of them is amplifying is not in that interval, and is computed here." }, { "id": "453-shedding-load-shed-what-would-have-relieved-it", "path": "/ai/examples/453-shedding-load-shed-what-would-have-relieved-it.eml.md", "title": "Shedding load shed what would have relieved it", "description": "`shedding_load_shed_what_would_have_relieved_it.eml` - Under overload the requests nobody is waiting on are refused first. What that does to the next interval is simulated rather than assumed." }, { "id": "454-the-cache-decided-what-was-popular", "path": "/ai/examples/454-the-cache-decided-what-was-popular.eml.md", "title": "The cache decided what was popular", "description": "`the_cache_decided_what_was_popular.eml` - The cache holds the most requested items, and being held is part of why they are requested. Which items it settles on is simulated rather than assumed." }, { "id": "455-the-experiment-ran-inside-the-loop", "path": "/ai/examples/455-the-experiment-ran-inside-the-loop.eml.md", "title": "The experiment ran inside the loop", "description": "`the_experiment_ran_inside_the_loop.eml` - The A/B test was clean: random assignment, one change, a large sample, a clear result. How much of the measured lift is the treatment is computed below." }, { "id": "456-the-improvement-was-the-loop-settling", "path": "/ai/examples/456-the-improvement-was-the-loop-settling.eml.md", "title": "The improvement was the loop settling", "description": "`the_improvement_was_the_loop_settling.eml` - A metric improved for six months after an initiative started. What else predicts that curve is computed below." }, { "id": "457-the-padding-was-consumed-so-it-was-increased", "path": "/ai/examples/457-the-padding-was-consumed-so-it-was-increased.eml.md", "title": "The padding was consumed so it was increased", "description": "`the_padding_was_consumed_so_it_was_increased.eml` - Estimates kept being exceeded, so they were padded. What happened to the padding, and to the accuracy figure everyone watches, is simulated rather than assumed." }, { "id": "458-the-return-term-arrives-after-the-review", "path": "/ai/examples/458-the-return-term-arrives-after-the-review.eml.md", "title": "The return term arrives after the review", "description": "`the_return_term_arrives_after_the_review.eml` - Each change was reviewed two weeks after it shipped. What each one is worth at two weeks and at six months is computed below." }, { "id": "459-the-reviewer-got-stricter-and-the-author-leaned-on-it", "path": "/ai/examples/459-the-reviewer-got-stricter-and-the-author-leaned-on-it.eml.md", "title": "The reviewer got stricter and the author leaned on it", "description": "`the_reviewer_got_stricter_and_the_author_leaned_on_it.eml` - Review got stricter because defects were escaping, and self-checking got lighter because review was catching things. Where the pair settles is simulated." }, { "id": "460-the-static-split-was-the-one-that-diverged", "path": "/ai/examples/460-the-static-split-was-the-one-that-diverged.eml.md", "title": "The static split was the one that diverged", "description": "`the_static_split_was_the_one_that_diverged.eml` - The scaler moves workers towards whichever queue is deeper, and it acts on numbers that are already stale. Whether that makes it unstable is simulated rather than argued." }, { "id": "461-the-target-was-set-by-what-was-asked-for", "path": "/ai/examples/461-the-target-was-set-by-what-was-asked-for.eml.md", "title": "The target was set by what was asked for", "description": "`the_target_was_set_by_what_was_asked_for.eml` - The availability target was set to what consumers asked for, and consumers asked for what was published. What any of them needs is computed below." }, { "id": "462-the-clause-added-after-the-incident", "path": "/ai/examples/462-the-clause-added-after-the-incident.eml.md", "title": "The clause added after the incident", "description": "`the_clause_added_after_the_incident.eml` - A clause was added to the validator after an incident. What else it rejects is computed below." }, { "id": "463-the-compensated-sum-and-the-loop-disagree", "path": "/ai/examples/463-the-compensated-sum-and-the-loop-disagree.eml.md", "title": "The compensated sum and the loop disagree", "description": "`the_compensated_sum_and_the_loop_disagree.eml` - The same numbers added two ways give two answers. Which addition each way performs is computed below." }, { "id": "464-the-default-swallowed-a-real-zero", "path": "/ai/examples/464-the-default-swallowed-a-real-zero.eml.md", "title": "The default swallowed a real zero", "description": "`the_default_swallowed_a_real_zero.eml` - A missing setting falls back to the default. How many settings that are present also fall back is computed below." }, { "id": "465-the-guard-was-moved-for-readability", "path": "/ai/examples/465-the-guard-was-moved-for-readability.eml.md", "title": "The guard was moved for readability", "description": "`the_guard_was_moved_for_readability.eml` - The two clauses of a condition were swapped so the important one reads first. Which inputs that changes is computed below." }, { "id": "466-the-id-survived-the-hop-and-the-type-did-not", "path": "/ai/examples/466-the-id-survived-the-hop-and-the-type-did-not.eml.md", "title": "The id survived the hop and the type did not", "description": "`the_id_survived_the_hop_and_the_type_did_not.eml` - Identifiers go out as numbers and come back as numbers. How many of them come back as the same number is computed below." }, { "id": "467-the-loop-stopped-because-the-steps-got-small", "path": "/ai/examples/467-the-loop-stopped-because-the-steps-got-small.eml.md", "title": "The loop stopped because the steps got small", "description": "`the_loop_stopped_because_the_steps_got_small.eml` - The solver stops when a step is smaller than the tolerance. How far it still is from the answer at that moment is computed below." }, { "id": "468-the-negation-was-distributed-by-hand", "path": "/ai/examples/468-the-negation-was-distributed-by-hand.eml.md", "title": "The negation was distributed by hand", "description": "`the_negation_was_distributed_by_hand.eml` - A condition was inverted to turn a skip into a keep. Which inputs the inverted form treats differently is enumerated below." }, { "id": "469-the-order-the-workers-finished-changed-the-total", "path": "/ai/examples/469-the-order-the-workers-finished-changed-the-total.eml.md", "title": "The order the workers finished changed the total", "description": "`the_order_the_workers_finished_changed_the_total.eml` - Three workers return partial sums and the reducer adds them as they arrive. What the total depends on is computed below." }, { "id": "470-the-precision-was-set-by-the-narrowest-hop", "path": "/ai/examples/470-the-precision-was-set-by-the-narrowest-hop.eml.md", "title": "The precision was set by the narrowest hop", "description": "`the_precision_was_set_by_the_narrowest_hop.eml` - Five systems carry a timestamp and each documents its own resolution. Which one the chain has is computed below." }, { "id": "471-the-rounding-was-applied-at-every-step", "path": "/ai/examples/471-the-rounding-was-applied-at-every-step.eml.md", "title": "The rounding was applied at every step", "description": "`the_rounding_was_applied_at_every_step.eml` - Each line is rounded to the cent as it is computed, because a cent is what money is. What that costs over a run is computed below." }, { "id": "472-the-schema-allowed-it-and-every-consumer-assumed-otherwise", "path": "/ai/examples/472-the-schema-allowed-it-and-every-consumer-assumed-otherwise.eml.md", "title": "The schema allowed it and every consumer assumed otherwise", "description": "`the_schema_allowed_it_and_every_consumer_assumed_otherwise.eml` - The field is an array. How many consumers read anything but the first element is computed below." }, { "id": "473-the-test-was-shorter-than-the-wrap", "path": "/ai/examples/473-the-test-was-shorter-than-the-wrap.eml.md", "title": "The test was shorter than the wrap", "description": "`the_test_was_shorter_than_the_wrap.eml` - The ordering check compares sequence numbers with a greater-than. How many messages that is correct for is computed below." }, { "id": "474-the-unit-was-in-the-name-not-in-the-value", "path": "/ai/examples/474-the-unit-was-in-the-name-not-in-the-value.eml.md", "title": "The unit was in the name not in the value", "description": "`the_unit_was_in_the_name_not_in_the_value.eml` - Every field carries its unit in its name. How many of the arithmetic sites check that name is computed below." }, { "id": "475-the-zone-was-dropped-and-the-value-stayed-valid", "path": "/ai/examples/475-the-zone-was-dropped-and-the-value-stayed-valid.eml.md", "title": "The zone was dropped and the value stayed valid", "description": "`the_zone_was_dropped_and_the_value_stayed_valid.eml` - The zone was dropped at one hop and every timestamp is still a well-formed timestamp. How many of them now mean a different moment is computed below." }, { "id": "476-which-clause-actually-decided", "path": "/ai/examples/476-which-clause-actually-decided.eml.md", "title": "Which clause actually decided", "description": "`which_clause_actually_decided.eml` - Access is granted if the caller is an administrator or owns the record. How often each of those was the reason is computed below." }, { "id": "477-nobody-has-ever-passed-the-second-argument", "path": "/ai/examples/477-nobody-has-ever-passed-the-second-argument.eml.md", "title": "Nobody has ever passed the second argument", "description": "`nobody_has_ever_passed_the_second_argument.eml` - The function takes an optional second argument. How many call sites pass it is computed below, and so is what it costs to keep." }, { "id": "478-the-column-nobody-queried", "path": "/ai/examples/478-the-column-nobody-queried.eml.md", "title": "The column nobody queried", "description": "`the_column_nobody_queried.eml` - The column has been in the table for three years and no report has ever selected it. What is in it is computed below." }, { "id": "479-the-constant-was-chosen-by-someone-who-left", "path": "/ai/examples/479-the-constant-was-chosen-by-someone-who-left.eml.md", "title": "The constant was chosen by someone who left", "description": "`the_constant_was_chosen_by_someone_who_left.eml` - The constant is 4096 and nobody currently on the team knows why. What depends on it is computed below." }, { "id": "480-the-fallback-runs-only-when-everything-is-worst", "path": "/ai/examples/480-the-fallback-runs-only-when-everything-is-worst.eml.md", "title": "The fallback runs only when everything is worst", "description": "`the_fallback_runs_only_when_everything_is_worst.eml` - The fallback path has run four times in three years. What conditions it ran under is computed below, and it is not a coincidence." }, { "id": "481-the-fix-shipped-to-the-users-who-stayed", "path": "/ai/examples/481-the-fix-shipped-to-the-users-who-stayed.eml.md", "title": "The fix shipped to the users who stayed", "description": "`the_fix_shipped_to_the_users_who_stayed.eml` - The fix went out eleven months after the bug. How many of the affected users were still there to receive it is computed below." }, { "id": "482-the-interface-was-shaped-by-a-caller-that-is-gone", "path": "/ai/examples/482-the-interface-was-shaped-by-a-caller-that-is-gone.eml.md", "title": "The interface was shaped by a caller that is gone", "description": "`the_interface_was_shaped_by_a_caller_that_is_gone.eml` - Six features of this interface exist because of one integration. That integration was retired two years ago. What still depends on each is computed below." }, { "id": "483-the-limit-was-never-reached-so-it-was-never-wrong", "path": "/ai/examples/483-the-limit-was-never-reached-so-it-was-never-wrong.eml.md", "title": "The limit was never reached so it was never wrong", "description": "`the_limit_was_never_reached_so_it_was_never_wrong.eml` - The limit has been in the config for four years and has never been hit. What is known about the code behind it is computed below." }, { "id": "484-the-name-outlived-the-thing-it-named", "path": "/ai/examples/484-the-name-outlived-the-thing-it-named.eml.md", "title": "The name outlived the thing it named", "description": "`the_name_outlived_the_thing_it_named.eml` - The product was renamed four years ago. Where the old name still is, and what it now means in each place, is computed below." }, { "id": "485-the-quiet-hours-are-somebody-elses-peak", "path": "/ai/examples/485-the-quiet-hours-are-somebody-elses-peak.eml.md", "title": "The quiet hours are somebody elses peak", "description": "`the_quiet_hours_are_somebody_elses_peak.eml` - Deploys go out at two in the morning, when traffic is lowest. Whose traffic is lowest is computed below." }, { "id": "486-the-reporters-are-not-the-affected", "path": "/ai/examples/486-the-reporters-are-not-the-affected.eml.md", "title": "The reporters are not the affected", "description": "`the_reporters_are_not_the_affected.eml` - Forty-one people reported the bug. How many hit it is computed below, and the two numbers are about different populations." }, { "id": "487-the-rollback-has-never-been-run", "path": "/ai/examples/487-the-rollback-has-never-been-run.eml.md", "title": "The rollback has never been run", "description": "`the_rollback_has_never_been_run.eml` - Every migration ships with a rollback. How much of the data a rollback would return is computed below." }, { "id": "488-the-schema-still-enforces-a-rule-that-ended", "path": "/ai/examples/488-the-schema-still-enforces-a-rule-that-ended.eml.md", "title": "The schema still enforces a rule that ended", "description": "`the_schema_still_enforces_a_rule_that_ended.eml` - Six constraints in the schema encode business rules. How many of those rules are still policy is computed below." }, { "id": "489-the-team-inherited-the-oncall-and-not-the-decisions", "path": "/ai/examples/489-the-team-inherited-the-oncall-and-not-the-decisions.eml.md", "title": "The team inherited the oncall and not the decisions", "description": "`the_team_inherited_the_oncall_and_not_the_decisions.eml` - The current team has owned this service for eleven months. Which decisions the last year of pages trace back to is computed below." }, { "id": "490-the-team-is-on-the-fast-network", "path": "/ai/examples/490-the-team-is-on-the-fast-network.eml.md", "title": "The team is on the fast network", "description": "`the_team_is_on_the_fast_network.eml` - Every latency measurement the team takes is honest. What population it describes is computed below." }, { "id": "491-the-two-teams-never-see-the-same-error", "path": "/ai/examples/491-the-two-teams-never-see-the-same-error.eml.md", "title": "The two teams never see the same error", "description": "`the_two_teams_never_see_the_same_error.eml` - The client team sees failures the server team cannot find. Both dashboards are correct, and what each one can contain is computed below." }, { "id": "492-enforcement-decayed-with-distance-from-the-author", "path": "/ai/examples/492-enforcement-decayed-with-distance-from-the-author.eml.md", "title": "Enforcement decayed with distance from the author", "description": "`enforcement_decayed_with_distance_from_the_author.eml` - The convention is followed closely in the files its author touches and loosely elsewhere. The gradient is computed below." }, { "id": "493-fixing-the-retry-storm-let-the-cache-go-cold", "path": "/ai/examples/493-fixing-the-retry-storm-let-the-cache-go-cold.eml.md", "title": "Fixing the retry storm let the cache go cold", "description": "`fixing_the_retry_storm_let_the_cache_go_cold.eml` - The retry storm was fixed and the cache hit rate fell. What the retries had been doing is computed below." }, { "id": "494-silent-corruption-became-a-visible-error-graph", "path": "/ai/examples/494-silent-corruption-became-a-visible-error-graph.eml.md", "title": "Silent corruption became a visible error graph", "description": "`silent_corruption_became_a_visible_error_graph.eml` - Validation was added and the error rate went from near zero to four percent. What changed is computed below." }, { "id": "495-the-breach-was-priced-by-who-found-it", "path": "/ai/examples/495-the-breach-was-priced-by-who-found-it.eml.md", "title": "The breach was priced by who found it", "description": "`the_breach_was_priced_by_who_found_it.eml` - Eight incidents of the same rule being broken. What each one cost the team that broke it is computed below, alongside what it cost the company." }, { "id": "496-the-dedup-removed-the-copy-that-was-the-backup", "path": "/ai/examples/496-the-dedup-removed-the-copy-that-was-the-backup.eml.md", "title": "The dedup removed the copy that was the backup", "description": "`the_dedup_removed_the_copy_that_was_the_backup.eml` - Duplicate storage was removed and 40% of the bill went with it. What each duplicate had been doing is computed below." }, { "id": "497-the-environment-was-booked-by-whoever-booked-first", "path": "/ai/examples/497-the-environment-was-booked-by-whoever-booked-first.eml.md", "title": "The environment was booked by whoever booked first", "description": "`the_environment_was_booked_by_whoever_booked_first.eml` - One staging environment, booked first-come. Who gets it and who needs it are computed below." }, { "id": "498-the-escalation-bought-time-that-was-not-spare", "path": "/ai/examples/498-the-escalation-bought-time-that-was-not-spare.eml.md", "title": "The escalation bought time that was not spare", "description": "`the_escalation_bought_time_that_was_not_spare.eml` - Seven requests were escalated this quarter and all seven were served first. Where the time came from is computed below." }, { "id": "499-the-fix-made-the-next-bottleneck-the-unknown-one", "path": "/ai/examples/499-the-fix-made-the-next-bottleneck-the-unknown-one.eml.md", "title": "The fix made the next bottleneck the unknown one", "description": "`the_fix_made_the_next_bottleneck_the_unknown_one.eml` - The slowest stage was made four times faster. What that did to the pipeline, which stage is the constraint now, and how well that one is understood are all computed below." }, { "id": "500-the-index-was-added-for-the-query-that-complained", "path": "/ai/examples/500-the-index-was-added-for-the-query-that-complained.eml.md", "title": "The index was added for the query that complained", "description": "`the_index_was_added_for_the_query_that_complained.eml` - Nine indexes, each added after somebody reported a slow query. What they cost and what they save is computed below." }, { "id": "501-the-limit-was-raised-for-everyone-who-asked", "path": "/ai/examples/501-the-limit-was-raised-for-everyone-who-asked.eml.md", "title": "The limit was raised for everyone who asked", "description": "`the_limit_was_raised_for_everyone_who_asked.eml` - The default rate limit has not moved in three years. Which callers are still on it is computed below." }, { "id": "502-the-quota-went-to-whoever-was-in-the-room", "path": "/ai/examples/502-the-quota-went-to-whoever-was-in-the-room.eml.md", "title": "The quota went to whoever was in the room", "description": "`the_quota_went_to_whoever_was_in_the_room.eml` - The quarter's compute budget was divided in a planning meeting. How the shares compare to what each team runs is computed below." }, { "id": "503-the-rule-binds-the-party-with-no-leverage", "path": "/ai/examples/503-the-rule-binds-the-party-with-no-leverage.eml.md", "title": "The rule binds the party with no leverage", "description": "`the_rule_binds_the_party_with_no_leverage.eml` - The integration standard applies to every partner. Which partners it has actually been applied to is computed below." }, { "id": "504-the-same-rule-blocks-here-and-warns-there", "path": "/ai/examples/504-the-same-rule-blocks-here-and-warns-there.eml.md", "title": "The same rule blocks here and warns there", "description": "`the_same_rule_blocks_here_and_warns_there.eml` - One policy, six pipelines, three enforcement levels. Where the violations end up is computed below." }, { "id": "505-the-speedup-changed-a-race-that-had-always-won", "path": "/ai/examples/505-the-speedup-changed-a-race-that-had-always-won.eml.md", "title": "The speedup changed a race that had always won", "description": "`the_speedup_changed_a_race_that_had_always_won.eml` - Two writers have always raced and one has always won by a wide margin. What the margin was, and what a speedup on the other side does to it, are computed below." }, { "id": "506-the-waiver-went-to-whoever-knew-to-ask", "path": "/ai/examples/506-the-waiver-went-to-whoever-knew-to-ask.eml.md", "title": "The waiver went to whoever knew to ask", "description": "`the_waiver_went_to_whoever_knew_to_ask.eml` - The policy has an exception process. Which teams used it, and which teams qualified, are two different sets, computed below." }, { "id": "507-every-quarter-deferring-the-upgrade-was-correct", "path": "/ai/examples/507-every-quarter-deferring-the-upgrade-was-correct.eml.md", "title": "Every quarter deferring the upgrade was correct", "description": "`every_quarter_deferring_the_upgrade_was_correct.eml` - A dependency upgrade was deferred eight quarters running. Each deferral is scored under two different rules below, and the accumulated bill is computed." }, { "id": "508-full-compliance-was-reached-by-changing-the-denominator", "path": "/ai/examples/508-full-compliance-was-reached-by-changing-the-denominator.eml.md", "title": "Full compliance was reached by changing the denominator", "description": "`full_compliance_was_reached_by_changing_the_denominator.eml` - A security standard reached 100% compliance. How many repositories changed and how many left the denominator are counted separately below." }, { "id": "509-nobody-filed-an-exception-so-the-rule-fits", "path": "/ai/examples/509-nobody-filed-an-exception-so-the-rule-fits.eml.md", "title": "Nobody filed an exception so the rule fits", "description": "`nobody_filed_an_exception_so_the_rule_fits.eml` - A coding standard has drawn two exception requests in eighteen months, and both were granted. What that low number measures is computed below, against what it is being read as measuring." }, { "id": "510-silence-was-recorded-as-assent", "path": "/ai/examples/510-silence-was-recorded-as-assent.eml.md", "title": "Silence was recorded as assent", "description": "`silence_was_recorded_as_assent.eml` - A proposal process counts a non-response as approval. What the approvals mean is computed below by separating the votes that were cast from the votes that were assumed." }, { "id": "511-the-complaints-stopped-but-the-traffic-did-not", "path": "/ai/examples/511-the-complaints-stopped-but-the-traffic-did-not.eml.md", "title": "The complaints stopped but the traffic did not", "description": "`the_complaints_stopped_but_the_traffic_did_not.eml` - A deprecated API stopped generating complaints and was scheduled for removal on that basis. Complaints and calls are counted separately below." }, { "id": "512-the-disk-was-doubled-and-the-retention-policy-relaxed", "path": "/ai/examples/512-the-disk-was-doubled-and-the-retention-policy-relaxed.eml.md", "title": "The disk was doubled and the retention policy relaxed", "description": "`the_disk_was_doubled_and_the_retention_policy_relaxed.eml` - Storage was doubled and was full again in four months. Whether the data rate grew is computed below, separately from whether the policy did." }, { "id": "513-the-field-was-made-required-by-one-team", "path": "/ai/examples/513-the-field-was-made-required-by-one-team.eml.md", "title": "The field was made required by one team", "description": "`the_field_was_made_required_by_one_team.eml` - A producer added one required field to a shared event. What that cost the producer and what it cost everybody else are computed below." }, { "id": "514-the-limit-was-raised-and-the-polling-followed-it", "path": "/ai/examples/514-the-limit-was-raised-and-the-polling-followed-it.eml.md", "title": "The limit was raised and the polling followed it", "description": "`the_limit_was_raised_and_the_polling_followed_it.eml` - A rate limit was raised from 60 to 300 requests a minute. What the callers did with the extra allowance is computed below, alongside how often the answer had changed." }, { "id": "515-the-log-level-was-set-by-the-writer", "path": "/ai/examples/515-the-log-level-was-set-by-the-writer.eml.md", "title": "The log level was set by the writer", "description": "`the_log_level_was_set_by_the_writer.eml` - Each service team sets its own log level. The bill arrives at a team that cannot change any of them. Both quantities are computed below." }, { "id": "516-the-memory-limit-was-doing-the-design-review", "path": "/ai/examples/516-the-memory-limit-was-doing-the-design-review.eml.md", "title": "The memory limit was doing the design review", "description": "`the_memory_limit_was_doing_the_design_review.eml` - A query memory limit was raised from 4 GB to 16 GB. What the analysts wrote afterwards is computed below, along with what the old limit had been doing." }, { "id": "517-the-objections-stopped-and-so-did-the-objectors", "path": "/ai/examples/517-the-objections-stopped-and-so-did-the-objectors.eml.md", "title": "The objections stopped and so did the objectors", "description": "`the_objections_stopped_and_so_did_the_objectors.eml` - A design review series records fewer objections every quarter. Where the objections went and where the objectors went are computed separately below." }, { "id": "518-the-pool-doubled-and-the-backlog-did-not-move", "path": "/ai/examples/518-the-pool-doubled-and-the-backlog-did-not-move.eml.md", "title": "The pool doubled and the backlog did not move", "description": "`the_pool_doubled_and_the_backlog_did_not_move.eml` - The worker pool was doubled and the overnight backlog is the same length it was. What changed and what did not are computed below." }, { "id": "519-the-retry-budget-was-set-by-the-caller", "path": "/ai/examples/519-the-retry-budget-was-set-by-the-caller.eml.md", "title": "The retry budget was set by the caller", "description": "`the_retry_budget_was_set_by_the_caller.eml` - Every caller configures its own retry count. What each caller pays and what each caller costs are computed below, and they are not the same number." }, { "id": "520-the-test-was-added-to-everyones-suite", "path": "/ai/examples/520-the-test-was-added-to-everyones-suite.eml.md", "title": "The test was added to everyones suite", "description": "`the_test_was_added_to_everyones_suite.eml` - One team added a 40-second test to the shared pre-merge suite. What it protects and what it costs are both computed below, and the answer is not that the test is bad." }, { "id": "521-three-times-the-runners-and-the-same-queue", "path": "/ai/examples/521-three-times-the-runners-and-the-same-queue.eml.md", "title": "Three times the runners and the same queue", "description": "`three_times_the_runners_and_the_same_queue.eml` - CI runners went from 8 to 24 and the median wait is back where it started. What changed in between is computed below, and it is not the amount of code." }, { "id": "522-every-request-went-through-her-so-no-form-was-built", "path": "/ai/examples/522-every-request-went-through-her-so-no-form-was-built.eml.md", "title": "Every request went through her so no form was built", "description": "`every_request_went_through_her_so_no_form_was_built.eml` - A routing config is written in a format one person understands. What her turnaround does to the case for a self-serve form is computed below." }, { "id": "523-one-reviewer-on-every-change-and-no-second-reader", "path": "/ai/examples/523-one-reviewer-on-every-change-and-no-second-reader.eml.md", "title": "One reviewer on every change and no second reader", "description": "`one_reviewer_on_every_change_and_no_second_reader.eml` - One engineer reviews every change to a module. What that does to how many people can read it is computed below." }, { "id": "524-the-breaker-tripped-on-the-limiters-own-rejections", "path": "/ai/examples/524-the-breaker-tripped-on-the-limiters-own-rejections.eml.md", "title": "The breaker tripped on the limiters own rejections", "description": "`the_breaker_tripped_on_the_limiters_own_rejections.eml` - A rate limiter and a circuit breaker both protect the same downstream service. What each one sees, and what the pair sees, are computed separately below." }, { "id": "525-the-buffer-absorbed-the-signal-backpressure-needed", "path": "/ai/examples/525-the-buffer-absorbed-the-signal-backpressure-needed.eml.md", "title": "The buffer absorbed the signal backpressure needed", "description": "`the_buffer_absorbed_the_signal_backpressure_needed.eml` - A queue has both a buffer to absorb bursts and backpressure to slow the producer. When each one engages is computed below." }, { "id": "526-the-enum-grew-and-the-else-branch-absorbed-it", "path": "/ai/examples/526-the-enum-grew-and-the-else-branch-absorbed-it.eml.md", "title": "The enum grew and the else branch absorbed it", "description": "`the_enum_grew_and_the_else_branch_absorbed_it.eml` - A status field gained three new values. The field name, the type and the wire format did not change. What each consumer now does with those values is computed below." }, { "id": "527-the-expert-keeps-the-recovery-time-below-the-threshold", "path": "/ai/examples/527-the-expert-keeps-the-recovery-time-below-the-threshold.eml.md", "title": "The expert keeps the recovery time below the threshold", "description": "`the_expert_keeps_the_recovery_time_below_the_threshold.eml` - A module is hard to debug and one engineer is very good at debugging it. What that does to the case for simplifying it is computed below." }, { "id": "528-the-field-stopped-being-null-and-killed-the-branch", "path": "/ai/examples/528-the-field-stopped-being-null-and-killed-the-branch.eml.md", "title": "The field stopped being null and killed the branch", "description": "`the_field_stopped_being_null_and_killed_the_branch.eml` - A nullable field was backfilled and now always has a value. What that did to the code written for the null case is computed below." }, { "id": "529-the-health-check-hid-the-shortfall-from-the-autoscaler", "path": "/ai/examples/529-the-health-check-hid-the-shortfall-from-the-autoscaler.eml.md", "title": "The health check hid the shortfall from the autoscaler", "description": "`the_health_check_hid_the_shortfall_from_the_autoscaler.eml` - A health check removes unhealthy instances and an autoscaler adds capacity when the fleet is loaded. What each measures is computed below." }, { "id": "530-the-id-stayed-a-string-and-stopped-being-unique", "path": "/ai/examples/530-the-id-stayed-a-string-and-stopped-being-unique.eml.md", "title": "The id stayed a string and stopped being unique", "description": "`the_id_stayed_a_string_and_stopped_being_unique.eml` - An order id was globally unique and became unique per tenant. Same field, same string type, same length. When that matters is computed below." }, { "id": "531-the-rate-field-moved-from-a-fraction-to-a-percentage", "path": "/ai/examples/531-the-rate-field-moved-from-a-fraction-to-a-percentage.eml.md", "title": "The rate field moved from a fraction to a percentage", "description": "`the_rate_field_moved_from_a_fraction_to_a_percentage.eml` - A discount_rate field carried 0.15 and now carries 15. Same name, same numeric type. Which consumers noticed is computed below." }, { "id": "532-the-remediation-fixed-it-before-anyone-could-be-told", "path": "/ai/examples/532-the-remediation-fixed-it-before-anyone-could-be-told.eml.md", "title": "The remediation fixed it before anyone could be told", "description": "`the_remediation_fixed_it_before_anyone_could_be_told.eml` - Auto-remediation restarts the failing process and alert deduplication suppresses the repeat. What each does, and what the pair does to escalation, are computed below." }, { "id": "533-the-sanitiser-made-the-bad-input-pass-validation", "path": "/ai/examples/533-the-sanitiser-made-the-bad-input-pass-validation.eml.md", "title": "The sanitiser made the bad input pass validation", "description": "`the_sanitiser_made_the_bad_input_pass_validation.eml` - A sanitiser and a validator both guard the same intake. What each rejects, and what the pair rejects, are computed separately below." }, { "id": "534-the-shim-is-maintained-so-the-migration-never-finishes", "path": "/ai/examples/534-the-shim-is-maintained-so-the-migration-never-finishes.eml.md", "title": "The shim is maintained so the migration never finishes", "description": "`the_shim_is_maintained_so_the_migration_never_finishes.eml` - A compatibility shim translates between an old schema and a new one. One person maintains it by hand. What that does to the migration is computed below." }, { "id": "535-the-timestamp-changed-from-event-time-to-ingest-time", "path": "/ai/examples/535-the-timestamp-changed-from-event-time-to-ingest-time.eml.md", "title": "The timestamp changed from event time to ingest time", "description": "`the_timestamp_changed_from_event_time_to_ingest_time.eml` - A field called occurred_at changed from the time the event happened to the time the pipeline received it. Same name, same type, same format. What moved is computed below." }, { "id": "536-the-tool-is-slow-and-the-only-user-is-fast", "path": "/ai/examples/536-the-tool-is-slow-and-the-only-user-is-fast.eml.md", "title": "The tool is slow and the only user is fast", "description": "`the_tool_is_slow_and_the_only_user_is_fast.eml` - An internal tool takes many steps to do anything. Its recorded task time is good. Who produced that number is computed below." }, { "id": "537-the-adoption-was-measured-where-there-was-no-alternative", "path": "/ai/examples/537-the-adoption-was-measured-where-there-was-no-alternative.eml.md", "title": "The adoption was measured where there was no alternative", "description": "`the_adoption_was_measured_where_there_was_no_alternative.eml` - The new internal tool reports 96 percent adoption in its fourth quarter. What the number is measuring is computed below." }, { "id": "538-the-boost-was-a-loan-and-nobody-counted-the-lenders", "path": "/ai/examples/538-the-boost-was-a-loan-and-nobody-counted-the-lenders.eml.md", "title": "The boost was a loan and nobody counted the lenders", "description": "`the_boost_was_a_loan_and_nobody_counted_the_lenders.eml` - A low-priority task held a lock that a high-priority task needed, and medium-priority work ran ahead of both. Priority inheritance fixed it. What the fix cost over the following twelve weeks is computed below." }, { "id": "539-the-candidate-who-could-not-win-decided-the-winner", "path": "/ai/examples/539-the-candidate-who-could-not-win-decided-the-winner.eml.md", "title": "The candidate who could not win decided the winner", "description": "`the_candidate_who_could_not_win_decided_the_winner.eml` - Seventeen people rank three proposals. One proposal wins under none of the three counting rules. What happens to the result when it is taken off the ballot is computed below." }, { "id": "540-the-constraint-was-on-the-wrong-pair-of-columns", "path": "/ai/examples/540-the-constraint-was-on-the-wrong-pair-of-columns.eml.md", "title": "The constraint was on the wrong pair of columns", "description": "`the_constraint_was_on_the_wrong_pair_of_columns.eml` - A unique constraint on room and start time, protecting a rule about rooms not being double booked. What it accepts and what it refuses is counted below." }, { "id": "541-the-cost-appeared-only-when-it-stopped-being-paid", "path": "/ai/examples/541-the-cost-appeared-only-when-it-stopped-being-paid.eml.md", "title": "The cost appeared only when it stopped being paid", "description": "`the_cost_appeared_only_when_it_stopped_being_paid.eml` - A weekly maintenance job was cancelled after 140 runs that each reported nothing found. When the bill arrived, and who was blamed for it, are computed below." }, { "id": "542-the-counter-was-emptied-by-whoever-read-it-first", "path": "/ai/examples/542-the-counter-was-emptied-by-whoever-read-it-first.eml.md", "title": "The counter was emptied by whoever read it first", "description": "`the_counter_was_emptied_by_whoever_read_it_first.eml` - A counter that reports events since the last read, and a second collector added during a region migration. What each collector sees afterwards is computed below." }, { "id": "543-the-depth-limit-was-shared-with-the-caller", "path": "/ai/examples/543-the-depth-limit-was-shared-with-the-caller.eml.md", "title": "The depth limit was shared with the caller", "description": "`the_depth_limit_was_shared_with_the_caller.eml` - A recursive tree walker is documented as supporting trees up to 497 levels deep. The same record that passes in the test suite fails in the request handler. What changed between the two is computed below." }, { "id": "544-the-escape-was-correct-at-every-layer", "path": "/ai/examples/544-the-escape-was-correct-at-every-layer.eml.md", "title": "The escape was correct at every layer", "description": "`the_escape_was_correct_at_every_layer.eml` - Customer names are escaped when they arrive and escaped again when they are rendered. What each output route shows is computed below." }, { "id": "545-the-hash-was-uniform-and-the-buckets-were-not", "path": "/ai/examples/545-the-hash-was-uniform-and-the-buckets-were-not.eml.md", "title": "The hash was uniform and the buckets were not", "description": "`the_hash_was_uniform_and_the_buckets_were_not.eml` - The hash was tested for uniformity and passed. The bucket occupancy in production is counted below, from the same hash." }, { "id": "546-the-latency-was-measured-at-the-wrong-end", "path": "/ai/examples/546-the-latency-was-measured-at-the-wrong-end.eml.md", "title": "The latency was measured at the wrong end", "description": "`the_latency_was_measured_at_the_wrong_end.eml` - Three endpoints were changed to stream their results instead of building the whole response first. The latency dashboard recorded the best week it had ever seen. What the clients saw is computed below." }, { "id": "547-the-limit-was-per-key-and-the-caller-chose-the-key", "path": "/ai/examples/547-the-limit-was-per-key-and-the-caller-chose-the-key.eml.md", "title": "The limit was per key and the caller chose the key", "description": "`the_limit_was_per_key_and_the_caller_chose_the_key.eml` - The rate limiter allows 100 requests a minute per client, and it has never allowed a bucket to exceed 100. What it allowed in total is computed below." }, { "id": "548-the-load-test-used-the-shape-production-never-has", "path": "/ai/examples/548-the-load-test-used-the-shape-production-never-has.eml.md", "title": "The load test used the shape production never has", "description": "`the_load_test_used_the_shape_production_never_has.eml` - The load test sends 8000 requests spread evenly over 8 shards. Production sends 8000 requests too. Which numbers the two runs agree on is computed below." }, { "id": "549-the-mask-removed-the-value-and-kept-the-length", "path": "/ai/examples/549-the-mask-removed-the-value-and-kept-the-length.eml.md", "title": "The mask removed the value and kept the length", "description": "`the_mask_removed_the_value_and_kept_the_length.eml` - Customer names and email local parts are masked in the application log, one asterisk per character. How many customers the masked log still identifies uniquely is counted below." }, { "id": "550-the-restore-was-the-path-that-never-ran", "path": "/ai/examples/550-the-restore-was-the-path-that-never-ran.eml.md", "title": "The restore was the path that never ran", "description": "`the_restore_was_the_path_that_never_ran.eml` - The backup has succeeded 412 nights in a row. How much of the restore path that number covers is computed below." }, { "id": "551-three-copies-and-two-places-to-lose-them", "path": "/ai/examples/551-three-copies-and-two-places-to-lose-them.eml.md", "title": "Three copies and two places to lose them", "description": "`three_copies_and_two_places_to_lose_them.eml` - Every shard has three replicas, verified continuously, never fewer. How many shards survive the loss of one rack is computed below." }, { "id": "552-the-alert-threshold-was-set-from-the-week-it-was-written", "path": "/ai/examples/552-the-alert-threshold-was-set-from-the-week-it-was-written.eml.md", "title": "The alert threshold was set from the week it was written", "description": "`the_alert_threshold_was_set_from_the_week_it_was_written.eml` - An alert fires when requests per second cross 2400. That number was chosen in month 0 as twice the busiest second of the week the alert was written. What it means in each later month is computed below." }, { "id": "553-the-audit-sampled-the-records-that-were-easiest-to-fetch", "path": "/ai/examples/553-the-audit-sampled-the-records-that-were-easiest-to-fetch.eml.md", "title": "The audit sampled the records that were easiest to fetch", "description": "`the_audit_sampled_the_records_that_were_easiest_to_fetch.eml` - An audit sampled 500 of 50000 accounts and found a defect rate of 4 per thousand. What that rate is a rate of is computed below." }, { "id": "554-the-buffer-was-sized-for-the-average-and-the-burst-was-the-point", "path": "/ai/examples/554-the-buffer-was-sized-for-the-average-and-the-burst-was-the-point.eml.md", "title": "The buffer was sized for the average and the burst was the point", "description": "`the_buffer_was_sized_for_the_average_and_the_burst_was_the_point.eml` - Events arrive at 100 a second on average. The buffer holds 200, which is twice the average, and the consumer drains 120 a second. What happens during the burst is computed below." }, { "id": "555-the-cheaper-path-was-taken-often-enough-to-cost-more", "path": "/ai/examples/555-the-cheaper-path-was-taken-often-enough-to-cost-more.eml.md", "title": "The cheaper path was taken often enough to cost more", "description": "`the_cheaper_path_was_taken_often_enough_to_cost_more.eml` - A request handler calls five things. The code review flagged the slowest of them. Which one that is depends on a sort order, and both orders are computed below." }, { "id": "556-the-compression-helped-until-the-data-stopped-being-similar", "path": "/ai/examples/556-the-compression-helped-until-the-data-stopped-being-similar.eml.md", "title": "The compression helped until the data stopped being similar", "description": "`the_compression_helped_until_the_data_stopped_being_similar.eml` - The archive ingests 1000 GB a month, every month, and has done for a year. What it stores is computed below, along with the capacity forecast that was written in month 1." }, { "id": "557-the-deadline-was-met-by-moving-what-counted-as-done", "path": "/ai/examples/557-the-deadline-was-met-by-moving-what-counted-as-done.eml.md", "title": "The deadline was met by moving what counted as done", "description": "`the_deadline_was_met_by_moving_what_counted_as_done.eml` - 120 features were committed for the quarter. The quarter closed at 79 percent complete. What 79 percent counted is computed below." }, { "id": "558-the-error-rate-fell-because-the-errors-moved", "path": "/ai/examples/558-the-error-rate-fell-because-the-errors-moved.eml.md", "title": "The error rate fell because the errors moved", "description": "`the_error_rate_fell_because_the_errors_moved.eml` - Service A's error rate went from 3 percent to 0.2 percent after one change. Where the errors went is computed below." }, { "id": "559-the-id-was-reused-after-the-thing-it-identified-was-gone", "path": "/ai/examples/559-the-id-was-reused-after-the-thing-it-identified-was-gone.eml.md", "title": "The id was reused after the thing it identified was gone", "description": "`the_id_was_reused_after_the_thing_it_identified_was_gone.eml` - The audit log holds 20000 references, each one an entity id captured at the time an action was taken. How many of them still name the entity they were written about is computed below." }, { "id": "560-the-lock-was-held-across-a-call-that-could-block", "path": "/ai/examples/560-the-lock-was-held-across-a-call-that-could-block.eml.md", "title": "The lock was held across a call that could block", "description": "`the_lock_was_held_across_a_call_that_could_block.eml` - A cache refresh is guarded by a mutex. The thread pool was raised from 8 to 32 and throughput did not move. What the pool size can and cannot change is computed below." }, { "id": "561-the-migration-finished-and-both-writers-kept-writing", "path": "/ai/examples/561-the-migration-finished-and-both-writers-kept-writing.eml.md", "title": "The migration finished and both writers kept writing", "description": "`the_migration_finished_and_both_writers_kept_writing.eml` - The migration from the old store to the new one completed twelve months ago and was signed off. Both stores are still being written to. What is in each of them is computed below." }, { "id": "562-the-ratio-was-stable-and-both-sides-were-shrinking", "path": "/ai/examples/562-the-ratio-was-stable-and-both-sides-were-shrinking.eml.md", "title": "The ratio was stable and both sides were shrinking", "description": "`the_ratio_was_stable_and_both_sides_were_shrinking.eml` - Conversion rate held at 3.0 percent for twelve months. What held it there is computed below." }, { "id": "563-the-sample-size-was-the-thing-that-changed", "path": "/ai/examples/563-the-sample-size-was-the-thing-that-changed.eml.md", "title": "The sample size was the thing that changed", "description": "`the_sample_size_was_the_thing_that_changed.eml` - Three quarters of latency review. Each quarter the team sampled transactions and reported the worst one they saw. The worst got worse every quarter. What else changed is computed below." }, { "id": "564-the-throughput-doubled-and-the-tail-got-worse", "path": "/ai/examples/564-the-throughput-doubled-and-the-tail-got-worse.eml.md", "title": "The throughput doubled and the tail got worse", "description": "`the_throughput_doubled_and_the_tail_got_worse.eml` - The batch size was raised from 10 to 100. Throughput went from 166 to 416 items a second. What a single request experiences is computed below." }, { "id": "565-the-total-was-capped-and-the-parts-were-not", "path": "/ai/examples/565-the-total-was-capped-and-the-parts-were-not.eml.md", "title": "The total was capped and the parts were not", "description": "`the_total_was_capped_and_the_parts_were_not.eml` - The cloud account has a hard spending cap of 10000 a month. Eight services share it. On day 7 the cap fired. Which services stopped is computed below." }, { "id": "566-the-work-was-split-evenly-and-the-workers-were-not", "path": "/ai/examples/566-the-work-was-split-evenly-and-the-workers-were-not.eml.md", "title": "The work was split evenly and the workers were not", "description": "`the_work_was_split_evenly_and_the_workers_were_not.eml` - A batch of 2400 documents is split across 8 workers. Every worker gets exactly 300. How long the batch takes, and how long the report says it takes, are computed below." }, { "id": "567-the-bug-was-fixed-in-the-library-and-the-vendored-copy-stayed", "path": "/ai/examples/567-the-bug-was-fixed-in-the-library-and-the-vendored-copy-stayed.eml.md", "title": "The bug was fixed in the library and the vendored copy stayed", "description": "`the_bug_was_fixed_in_the_library_and_the_vendored_copy_stayed.eml` - An advisory is published, the library ships a fix, and the dependency scanner reports every service patched. How many are running the fixed code is computed below." }, { "id": "568-the-deploy-was-atomic-and-the-config-was-not", "path": "/ai/examples/568-the-deploy-was-atomic-and-the-config-was-not.eml.md", "title": "The deploy was atomic and the config was not", "description": "`the_deploy_was_atomic_and_the_config_was_not.eml` - Code is deployed blue-green, so every instance switches at once. Configuration is polled every 60 seconds. What runs during those 60 seconds is computed below." }, { "id": "569-the-exchange-rate-was-right-and-its-timestamp-was-not", "path": "/ai/examples/569-the-exchange-rate-was-right-and-its-timestamp-was-not.eml.md", "title": "The exchange rate was right and its timestamp was not", "description": "`the_exchange_rate_was_right_and_its_timestamp_was_not.eml` - A payment is quoted in the customer's currency at authorization and settled three days later at capture. Both conversions use the published rate. The difference is computed below." }, { "id": "570-the-fix-was-verified-on-the-machine-that-had-the-fix", "path": "/ai/examples/570-the-fix-was-verified-on-the-machine-that-had-the-fix.eml.md", "title": "The fix was verified on the machine that had the fix", "description": "`the_fix_was_verified_on_the_machine_that_had_the_fix.eml` - A bug reproduces on 4 of 12 hosts. The fix was deployed to one host, verified there, and rolled out. What that verification could and could not have shown is computed below." }, { "id": "571-the-flag-defaulted-differently-in-two-places", "path": "/ai/examples/571-the-flag-defaulted-differently-in-two-places.eml.md", "title": "The flag defaulted differently in two places", "description": "`the_flag_defaulted_differently_in_two_places.eml` - One feature flag, read by the server and by the browser. Each side has a default for when the flag service cannot be reached. What the two defaults do together is computed below." }, { "id": "572-the-limit-was-on-the-response-and-the-cost-was-in-the-query", "path": "/ai/examples/572-the-limit-was-on-the-response-and-the-cost-was-in-the-query.eml.md", "title": "The limit was on the response and the cost was in the query", "description": "`the_limit_was_on_the_response_and_the_cost_was_in_the_query.eml` - The API returns at most 20 rows per call and the rate limiter counts calls. What one call costs the database is computed below." }, { "id": "573-the-log-was-sampled-and-the-rare-event-was-the-point", "path": "/ai/examples/573-the-log-was-sampled-and-the-rare-event-was-the-point.eml.md", "title": "The log was sampled and the rare event was the point", "description": "`the_log_was_sampled_and_the_rare_event_was_the_point.eml` - Request logging was sampled at 1 percent to bring the bill down. What each class of event looks like afterwards is computed below." }, { "id": "574-the-metric-came-from-a-view-that-filtered", "path": "/ai/examples/574-the-metric-came-from-a-view-that-filtered.eml.md", "title": "The metric came from a view that filtered", "description": "`the_metric_came_from_a_view_that_filtered.eml` - Three metrics are computed from one view. The view excludes cancelled orders. What each metric becomes is computed below." }, { "id": "575-the-number-was-right-and-the-label-came-from-another-query", "path": "/ai/examples/575-the-number-was-right-and-the-label-came-from-another-query.eml.md", "title": "The number was right and the label came from another query", "description": "`the_number_was_right_and_the_label_came_from_another_query.eml` - A report shows four regions and their totals. The names come from one query and the totals from another, joined by row position. What each region is shown as is computed below." }, { "id": "576-the-permission-was-checked-before-the-data-was-chosen", "path": "/ai/examples/576-the-permission-was-checked-before-the-data-was-chosen.eml.md", "title": "The permission was checked before the data was chosen", "description": "`the_permission_was_checked_before_the_data_was_chosen.eml` - A search returns the ten highest-scoring documents a user is allowed to see. The user reports that the page is nearly empty. How many results each ordering produces is computed below." }, { "id": "577-the-redundancy-shared-a-dependency", "path": "/ai/examples/577-the-redundancy-shared-a-dependency.eml.md", "title": "The redundancy shared a dependency", "description": "`the_redundancy_shared_a_dependency.eml` - The service runs in three availability zones. Each zone is measured at 99.9 percent. The availability the three of them actually provide is computed below." }, { "id": "578-the-rule-was-enforced-at-write-time-and-the-data-predated-it", "path": "/ai/examples/578-the-rule-was-enforced-at-write-time-and-the-data-predated-it.eml.md", "title": "The rule was enforced at write time and the data predated it", "description": "`the_rule_was_enforced_at_write_time_and_the_data_predated_it.eml` - A validation rule was added to the write path eighteen months ago. Every row written since satisfies it. What fraction of the table satisfies it is computed below." }, { "id": "579-the-timeout-was-longer-than-the-caller-patience", "path": "/ai/examples/579-the-timeout-was-longer-than-the-caller-patience.eml.md", "title": "The timeout was longer than the caller patience", "description": "`the_timeout_was_longer_than_the_caller_patience.eml` - The service times out a request after 30 seconds. The client library gives up after 5. What the server is doing between those two numbers is computed below." }, { "id": "580-the-two-clocks-agreed-on-duration-and-disagreed-on-order", "path": "/ai/examples/580-the-two-clocks-agreed-on-duration-and-disagreed-on-order.eml.md", "title": "The two clocks agreed on duration and disagreed on order", "description": "`the_two_clocks_agreed_on_duration_and_disagreed_on_order.eml` - A request crosses three services and is timestamped at every hop. The end-to-end duration is trusted and the hop ordering is trusted. Only one of them is safe, and which is computed below." }, { "id": "581-the-two-teams-agreed-on-the-word-and-not-the-meaning", "path": "/ai/examples/581-the-two-teams-agreed-on-the-word-and-not-the-meaning.eml.md", "title": "The two teams agreed on the word and not the meaning", "description": "`the_two_teams_agreed_on_the_word_and_not_the_meaning.eml` - Two teams report active users. The growth team says 42000, the platform team says 18000. Both queries are correct and the numbers they produce are computed below." }, { "id": "582-the-aggregate-was-cached-and-the-parts-were-live", "path": "/ai/examples/582-the-aggregate-was-cached-and-the-parts-were-live.eml.md", "title": "The aggregate was cached and the parts were live", "description": "`the_aggregate_was_cached_and_the_parts_were_live.eml` - One page shows a total at the top and the rows it totals underneath. The total is cached for five minutes; the rows are queried live. What the two disagree by is computed below." }, { "id": "583-the-backup-ran-nightly-and-the-change-was-hourly", "path": "/ai/examples/583-the-backup-ran-nightly-and-the-change-was-hourly.eml.md", "title": "The backup ran nightly and the change was hourly", "description": "`the_backup_ran_nightly_and_the_change_was_hourly.eml` - The backup has succeeded every night for four hundred nights. The recovery point objective is one hour. What is actually recoverable is computed below." }, { "id": "584-the-config-was-validated-at-startup-and-edited-at-runtime", "path": "/ai/examples/584-the-config-was-validated-at-startup-and-edited-at-runtime.eml.md", "title": "The config was validated at startup and edited at runtime", "description": "`the_config_was_validated_at_startup_and_edited_at_runtime.eml` - The configuration is validated on load: every field is type-checked, every range is bounded, every reference is resolved. How many of the month's config changes go through that validation is computed below." }, { "id": "585-the-count-was-distinct-and-the-join-multiplied-the-rows", "path": "/ai/examples/585-the-count-was-distinct-and-the-join-multiplied-the-rows.eml.md", "title": "The count was distinct and the join multiplied the rows", "description": "`the_count_was_distinct_and_the_join_multiplied_the_rows.eml` - A report joins orders to their line items so it can break revenue down by product category. Three numbers on the same report are computed below." }, { "id": "586-the-default-sort-made-the-diff-unreadable", "path": "/ai/examples/586-the-default-sort-made-the-diff-unreadable.eml.md", "title": "The default sort made the diff unreadable", "description": "`the_default_sort_made_the_diff_unreadable.eml` - A generated configuration file is regenerated on every build and committed. How much of each diff is a real change is computed below." }, { "id": "587-the-encoding-was-declared-and-the-bytes-disagreed", "path": "/ai/examples/587-the-encoding-was-declared-and-the-bytes-disagreed.eml.md", "title": "The encoding was declared and the bytes disagreed", "description": "`the_encoding_was_declared_and_the_bytes_disagreed.eml` - Every uploaded file declares its encoding, the importer honours the declaration, and the encoding validator passes 100 percent of records. How many names arrive correctly is computed below." }, { "id": "588-the-queue-had-no-maximum-and-the-memory-did", "path": "/ai/examples/588-the-queue-had-no-maximum-and-the-memory-did.eml.md", "title": "The queue had no maximum and the memory did", "description": "`the_queue_had_no_maximum_and_the_memory_did.eml` - The in-process queue has never rejected a message. How long that can continue is computed below." }, { "id": "589-the-record-was-corrected-and-the-derived-copy-was-not", "path": "/ai/examples/589-the-record-was-corrected-and-the-derived-copy-was-not.eml.md", "title": "The record was corrected and the derived copy was not", "description": "`the_record_was_corrected_and_the_derived_copy_was_not.eml` - Three hundred and forty records were corrected this quarter, each one verified against the source document. How many of the five places that hold a copy received the correction is computed below." }, { "id": "590-the-retry-preserved-the-request-and-not-the-context", "path": "/ai/examples/590-the-retry-preserved-the-request-and-not-the-context.eml.md", "title": "The retry preserved the request and not the context", "description": "`the_retry_preserved_the_request_and_not_the_context.eml` - A caller gives the service 5 seconds. The service retries a failing downstream call up to four times. How long the caller waits is computed below." }, { "id": "591-the-setting-was-global-and-the-need-was-per-request", "path": "/ai/examples/591-the-setting-was-global-and-the-need-was-per-request.eml.md", "title": "The setting was global and the need was per request", "description": "`the_setting_was_global_and_the_need_was_per_request.eml` - A formatting library reads its decimal separator from a process-wide setting. Requests arrive from locales that use different ones. How many requests are formatting against someone else's setting is computed below." }, { "id": "592-the-signature-covered-the-payload-and-not-the-headers", "path": "/ai/examples/592-the-signature-covered-the-payload-and-not-the-headers.eml.md", "title": "The signature covered the payload and not the headers", "description": "`the_signature_covered_the_payload_and_not_the_headers.eml` - Every incoming webhook is signed and every signature verifies. Which fields the signature actually covers is computed below." }, { "id": "593-the-summary-was-accurate-and-the-reader-inferred-more", "path": "/ai/examples/593-the-summary-was-accurate-and-the-reader-inferred-more.eml.md", "title": "The summary was accurate and the reader inferred more", "description": "`the_summary_was_accurate_and_the_reader_inferred_more.eml` - A security review is summarised in one line: reviewed the authentication flow, found three issues, all fixed. Every word of that is true. What a reader takes from it is computed below." }, { "id": "594-the-throttle-protected-the-service-and-moved-the-failure-out", "path": "/ai/examples/594-the-throttle-protected-the-service-and-moved-the-failure-out.eml.md", "title": "The throttle protected the service and moved the failure out", "description": "`the_throttle_protected_the_service_and_moved_the_failure_out.eml` - A rate limiter holds the service at its measured capacity. The service's error rate is zero and its latency is flat. What the system as a whole delivers is computed below." }, { "id": "595-the-throughput-was-measured-where-the-work-was-queued", "path": "/ai/examples/595-the-throughput-was-measured-where-the-work-was-queued.eml.md", "title": "The throughput was measured where the work was queued", "description": "`the_throughput_was_measured_where_the_work_was_queued.eml` - The throughput graph has read a steady 1200 per second all shift. What the system finished in that shift is computed below." }, { "id": "596-the-validation-ran-on-the-value-after-it-was-coerced", "path": "/ai/examples/596-the-validation-ran-on-the-value-after-it-was-coerced.eml.md", "title": "The validation ran on the value after it was coerced", "description": "`the_validation_ran_on_the_value_after_it_was_coerced.eml` - Quantity must be an integer between 1 and 999. The validator has never accepted a value outside that range. How many orders ship a quantity the customer did not choose is computed below." }, { "id": "597-the-alert-fired-once-and-the-condition-held-for-days", "path": "/ai/examples/597-the-alert-fired-once-and-the-condition-held-for-days.eml.md", "title": "The alert fired once and the condition held for days", "description": "`the_alert_fired_once_and_the_condition_held_for_days.eml` - A disk alert fires when free space crosses below fifteen percent. It fired once. What the condition did afterwards is computed below." }, { "id": "598-the-average-held-steady-and-every-user-got-slower", "path": "/ai/examples/598-the-average-held-steady-and-every-user-got-slower.eml.md", "title": "The average held steady and every user got slower", "description": "`the_average_held_steady_and_every_user_got_slower.eml` - Mean response time this quarter is within a hundredth of a millisecond of last quarter. Two groups of users make up that mean. What happened to each of them is computed below." }, { "id": "599-the-branch-was-behind-a-flag-that-never-turned-on", "path": "/ai/examples/599-the-branch-was-behind-a-flag-that-never-turned-on.eml.md", "title": "The branch was behind a flag that never turned on", "description": "`the_branch_was_behind_a_flag_that_never_turned_on.eml` - A rewritten pricing path sits behind a feature flag. The flag has defaulted off since the day it was added. What the branch's readiness has actually been measured against is computed below." }, { "id": "600-the-cache-was-warm-and-one-request-paid-for-all-of-them", "path": "/ai/examples/600-the-cache-was-warm-and-one-request-paid-for-all-of-them.eml.md", "title": "The cache was warm and one request paid for all of them", "description": "`the_cache_was_warm_and_one_request_paid_for_all_of_them.eml` - A computed page is cached with a sixty second expiry. The hit rate is above ninety-nine percent and mean latency is a few milliseconds. Who pays the recompute is computed below." }, { "id": "601-the-check-ran-on-a-copy-and-the-original-was-used", "path": "/ai/examples/601-the-check-ran-on-a-copy-and-the-original-was-used.eml.md", "title": "The check ran on a copy and the original was used", "description": "`the_check_ran_on_a_copy_and_the_original_was_used.eml` - Every request is normalised, then validated, and the validator has never passed a bad value. Which value the handler then uses is computed below." }, { "id": "602-the-column-was-indexed-and-the-query-cast-it-first", "path": "/ai/examples/602-the-column-was-indexed-and-the-query-cast-it-first.eml.md", "title": "The column was indexed and the query cast it first", "description": "`the_column_was_indexed_and_the_query_cast_it_first.eml` - A lookup column is indexed, the index is healthy, and the query filters on exactly that column. The query reads the whole table. What the index can be used for is computed below." }, { "id": "603-the-migration-was-idempotent-and-the-order-was-not", "path": "/ai/examples/603-the-migration-was-idempotent-and-the-order-was-not.eml.md", "title": "The migration was idempotent and the order was not", "description": "`the_migration_was_idempotent_and_the_order_was_not.eml` - A schema migration is twelve steps and every step is idempotent. It was replayed onto three shards and two of them ended up different. What idempotence covers is computed below." }, { "id": "604-the-mutex-guarded-the-handle-and-not-the-data", "path": "/ai/examples/604-the-mutex-guarded-the-handle-and-not-the-data.eml.md", "title": "The mutex guarded the handle and not the data", "description": "`the_mutex_guarded_the_handle_and_not_the_data.eml` - A cache maps keys to entry handles, and a mutex guards the map. Thirty-two threads run against it without a crash, without a corrupt map, and without a single lost entry. What the mutex is protecting is computed below." }, { "id": "605-the-percentile-improved-and-the-worst-case-got-worse", "path": "/ai/examples/605-the-percentile-improved-and-the-worst-case-got-worse.eml.md", "title": "The percentile improved and the worst case got worse", "description": "`the_percentile_improved_and_the_worst_case_got_worse.eml` - A hedged request was added: if the first attempt has not answered in a hundred milliseconds, send a second one and take whichever returns first. The p99 improved. What happened above the p99 is computed below." }, { "id": "606-the-queue-drained-and-the-oldest-item-was-never-served", "path": "/ai/examples/606-the-queue-drained-and-the-oldest-item-was-never-served.eml.md", "title": "The queue drained and the oldest item was never served", "description": "`the_queue_drained_and_the_oldest_item_was_never_served.eml` - A work queue is drained continuously, its depth is stable, and throughput matches arrivals. What happens to the item at the bottom is computed below." }, { "id": "607-the-quota-was-per-account-and-the-cost-was-per-shard", "path": "/ai/examples/607-the-quota-was-per-account-and-the-cost-was-per-shard.eml.md", "title": "The quota was per account and the cost was per shard", "description": "`the_quota_was_per_account_and_the_cost_was_per_shard.eml` - A shared cluster limits each account to a thousand queries an hour. No account has ever exceeded it. What a query costs the cluster is computed below." }, { "id": "608-the-retry-succeeded-and-the-first-attempt-also-landed", "path": "/ai/examples/608-the-retry-succeeded-and-the-first-attempt-also-landed.eml.md", "title": "The retry succeeded and the first attempt also landed", "description": "`the_retry_succeeded_and_the_first_attempt_also_landed.eml` - A client times out at two seconds and retries. The server is slower than that for a small share of requests, and it finishes them. What each party records is computed below." }, { "id": "609-the-two-teams-fixed-it-and-the-fixes-cancelled-out", "path": "/ai/examples/609-the-two-teams-fixed-it-and-the-fixes-cancelled-out.eml.md", "title": "The two teams fixed it and the fixes cancelled out", "description": "`the_two_teams_fixed_it_and_the_fixes_cancelled_out.eml` - An invoice total was off by the tax amount. Two teams found it and each shipped a correct fix. What the invoice does now is computed below." }, { "id": "610-the-units-agreed-and-the-reference-point-did-not", "path": "/ai/examples/610-the-units-agreed-and-the-reference-point-did-not.eml.md", "title": "The units agreed and the reference point did not", "description": "`the_units_agreed_and_the_reference_point_did_not.eml` - Two services report a timestamp in seconds. The units match, the types match, and a comparison between them type-checks. What the two numbers are counted from is computed below." }, { "id": "611-the-writes-were-ordered-and-the-readers-were-not", "path": "/ai/examples/611-the-writes-were-ordered-and-the-readers-were-not.eml.md", "title": "The writes were ordered and the readers were not", "description": "`the_writes_were_ordered_and_the_readers_were_not.eml` - Two writes are committed in order to a primary, and the second is never visible without the first. What a reader sees is computed below." }, { "id": "612-the-batch-committed-and-the-notification-did-not", "path": "/ai/examples/612-the-batch-committed-and-the-notification-did-not.eml.md", "title": "The batch committed and the notification did not", "description": "`the_batch_committed_and_the_notification_did_not.eml` - A batch writes rows inside a transaction and then tells the downstream service. The transaction is atomic. What \"and then\" costs is computed below." }, { "id": "613-the-diff-was-empty-and-the-behaviour-changed", "path": "/ai/examples/613-the-diff-was-empty-and-the-behaviour-changed.eml.md", "title": "The diff was empty and the behaviour changed", "description": "`the_diff_was_empty_and_the_behaviour_changed.eml` - Two builds of the same commit behave differently. The diff between them is empty. What was not in the diff is computed below." }, { "id": "614-the-error-budget-was-monthly-and-the-outage-was-not", "path": "/ai/examples/614-the-error-budget-was-monthly-and-the-outage-was-not.eml.md", "title": "The error budget was monthly and the outage was not", "description": "`the_error_budget_was_monthly_and_the_outage_was_not.eml` - Two months consume the same error budget to the tenth of a minute. What each one did to users is computed below." }, { "id": "615-the-fallback-value-was-plausible", "path": "/ai/examples/615-the-fallback-value-was-plausible.eml.md", "title": "The fallback value was plausible", "description": "`the_fallback_value_was_plausible.eml` - When a sensor does not answer, the reader returns the last known value. The dashboard shows a steady line. What a steady line means here is computed below." }, { "id": "616-the-fix-shipped-and-the-cache-still-had-the-old-answer", "path": "/ai/examples/616-the-fix-shipped-and-the-cache-still-had-the-old-answer.eml.md", "title": "The fix shipped and the cache still had the old answer", "description": "`the_fix_shipped_and_the_cache_still_had_the_old_answer.eml` - A fix is deployed to every server in forty seconds. The incident is closed. How long users keep seeing the bug is computed below." }, { "id": "617-the-key-was-rotated-and-the-old-one-still-worked", "path": "/ai/examples/617-the-key-was-rotated-and-the-old-one-still-worked.eml.md", "title": "The key was rotated and the old one still worked", "description": "`the_key_was_rotated_and_the_old_one_still_worked.eml` - Fourteen signing keys were rotated on schedule. Every rotation is recorded as complete. What the old keys can still do is computed below." }, { "id": "618-the-lock-was-released-before-the-result-was-visible", "path": "/ai/examples/618-the-lock-was-released-before-the-result-was-visible.eml.md", "title": "The lock was released before the result was visible", "description": "`the_lock_was_released_before_the_result_was_visible.eml` - A worker takes a lock, computes a value, writes it, and releases. The lock is held across the whole critical section. What a second worker sees at the moment of release is computed below." }, { "id": "619-the-null-was-cheaper-to-store-than-the-reason", "path": "/ai/examples/619-the-null-was-cheaper-to-store-than-the-reason.eml.md", "title": "The null was cheaper to store than the reason", "description": "`the_null_was_cheaper_to_store_than_the_reason.eml` - A column is null on nineteen percent of rows. Three different things produced those nulls. What can be recovered from them is computed below." }, { "id": "620-the-permission-was-granted-to-the-service-not-the-request", "path": "/ai/examples/620-the-permission-was-granted-to-the-service-not-the-request.eml.md", "title": "The permission was granted to the service not the request", "description": "`the_permission_was_granted_to_the_service_not_the_request.eml` - The reporting service holds one role. Every request it serves is authorised against that role. What the role has to be able to do is computed below." }, { "id": "621-the-quorum-was-three-and-two-shared-a-rack", "path": "/ai/examples/621-the-quorum-was-three-and-two-shared-a-rack.eml.md", "title": "The quorum was three and two shared a rack", "description": "`the_quorum_was_three_and_two_shared_a_rack.eml` - Every shard has three replicas on three distinct nodes and needs two to serve. The placement check passes on all of them. What a single rack failure removes is computed below." }, { "id": "622-the-sample-was-taken-after-the-filter", "path": "/ai/examples/622-the-sample-was-taken-after-the-filter.eml.md", "title": "The sample was taken after the filter", "description": "`the_sample_was_taken_after_the_filter.eml` - A quality audit draws five hundred records at random from the processed table and finds a defect rate of two per thousand. What that table contains is computed below." }, { "id": "623-the-schema-was-backward-compatible-and-the-data-was-not", "path": "/ai/examples/623-the-schema-was-backward-compatible-and-the-data-was-not.eml.md", "title": "The schema was backward compatible and the data was not", "description": "`the_schema_was_backward_compatible_and_the_data_was_not.eml` - A field is added with a default. Every old reader keeps working and the compatibility checker passes. What the old rows now say is computed below." }, { "id": "624-the-second-region-was-added-and-the-database-was-not", "path": "/ai/examples/624-the-second-region-was-added-and-the-database-was-not.eml.md", "title": "The second region was added and the database was not", "description": "`the_second_region_was_added_and_the_database_was_not.eml` - A second region was added and static content there is twenty-five times faster. Dynamic pages are slower than before. What moved and what did not is computed below." }, { "id": "625-the-tests-passed-in-the-order-they-were-written", "path": "/ai/examples/625-the-tests-passed-in-the-order-they-were-written.eml.md", "title": "The tests passed in the order they were written", "description": "`the_tests_passed_in_the_order_they_were_written.eml` - A suite of one thousand four hundred tests passes on every run. It has passed on every run for eleven months. What it passes in is computed below." }, { "id": "626-the-two-checks-agreed-and-they-shared-a-parser", "path": "/ai/examples/626-the-two-checks-agreed-and-they-shared-a-parser.eml.md", "title": "The two checks agreed and they shared a parser", "description": "`the_two_checks_agreed_and_they_shared_a_parser.eml` - Two validators, written by two teams for two entry points, agree on every input. What their agreement is evidence of is computed below." }, { "id": "627-the-backfill-used-todays-code-and-the-rows-were-old", "path": "/ai/examples/627-the-backfill-used-todays-code-and-the-rows-were-old.eml.md", "title": "The backfill used todays code and the rows were old", "description": "`the_backfill_used_todays_code_and_the_rows_were_old.eml` - Three years of events are reprocessed through the current pipeline, which is correct. How many recomputed values disagree with what was actually done is computed below." }, { "id": "628-the-certificate-was-valid-and-the-chain-was-not", "path": "/ai/examples/628-the-certificate-was-valid-and-the-chain-was-not.eml.md", "title": "The certificate was valid and the chain was not", "description": "`the_certificate_was_valid_and_the_chain_was_not.eml` - The leaf certificate is valid by every property a certificate has. Which clients can actually authenticate the server is computed below." }, { "id": "629-the-checksum-matched-and-the-file-was-truncated", "path": "/ai/examples/629-the-checksum-matched-and-the-file-was-truncated.eml.md", "title": "The checksum matched and the file was truncated", "description": "`the_checksum_matched_and_the_file_was_truncated.eml` - The stored object passes its integrity check on every pass, and has done for months. How much of the file is there is computed below." }, { "id": "630-the-column-was-encrypted-and-the-index-was-not", "path": "/ai/examples/630-the-column-was-encrypted-and-the-index-was-not.eml.md", "title": "The column was encrypted and the index was not", "description": "`the_column_was_encrypted_and_the_index_was_not.eml` - The column is encrypted and nobody with the disk has the key. How many rows a reader with the index alone can label is computed below." }, { "id": "631-the-compaction-reclaimed-space-and-the-reads-got-slower", "path": "/ai/examples/631-the-compaction-reclaimed-space-and-the-reads-got-slower.eml.md", "title": "The compaction reclaimed space and the reads got slower", "description": "`the_compaction_reclaimed_space_and_the_reads_got_slower.eml` - Compaction reclaimed thirty-eight percent of the store and the space metric is right. What reads cost afterwards is computed below." }, { "id": "632-the-config-reloaded-and-the-worker-kept-the-old-one", "path": "/ai/examples/632-the-config-reloaded-and-the-worker-kept-the-old-one.eml.md", "title": "The config reloaded and the worker kept the old one", "description": "`the_config_reloaded_and_the_worker_kept_the_old_one.eml` - The reload succeeded and the log line saying so is true. When the change reaches the last worker is computed below." }, { "id": "633-the-counter-was-atomic-and-the-pair-was-not", "path": "/ai/examples/633-the-counter-was-atomic-and-the-pair-was-not.eml.md", "title": "The counter was atomic and the pair was not", "description": "`the_counter_was_atomic_and_the_pair_was_not.eml` - Every increment of the seat counter is atomic and no increment has ever been lost. How many seats were sold is computed below." }, { "id": "634-the-deploy-rolled-back-and-the-migration-did-not", "path": "/ai/examples/634-the-deploy-rolled-back-and-the-migration-did-not.eml.md", "title": "The deploy rolled back and the migration did not", "description": "`the_deploy_rolled_back_and_the_migration_did_not.eml` - The rollback completed in ninety seconds and every instance is running the previous release. What the table holds afterwards is computed below." }, { "id": "635-the-hash-was-stable-and-the-ring-was-not", "path": "/ai/examples/635-the-hash-was-stable-and-the-ring-was-not.eml.md", "title": "The hash was stable and the ring was not", "description": "`the_hash_was_stable_and_the_ring_was_not.eml` - The hash is stable and only one thirteenth of keys move when a node is added. How many requests reach the wrong node anyway is computed below." }, { "id": "636-the-limit-was-checked-on-entry-and-the-work-grew-after", "path": "/ai/examples/636-the-limit-was-checked-on-entry-and-the-work-grew-after.eml.md", "title": "The limit was checked on entry and the work grew after", "description": "`the_limit_was_checked_on_entry_and_the_work_grew_after.eml` - The request body limit is enforced on every request and no oversized body has ever got through. What one accepted body costs is computed below." }, { "id": "637-the-lock-was-held-and-the-process-was-gone", "path": "/ai/examples/637-the-lock-was-held-and-the-process-was-gone.eml.md", "title": "The lock was held and the process was gone", "description": "`the_lock_was_held_and_the_process_was_gone.eml` - The lock is held and the store is right about that. How long the work waits for a holder that no longer exists is computed below." }, { "id": "638-the-log-said-success-and-the-exit-code-was-never-read", "path": "/ai/examples/638-the-log-said-success-and-the-exit-code-was-never-read.eml.md", "title": "The log said success and the exit code was never read", "description": "`the_log_said_success_and_the_exit_code_was_never_read.eml` - Every nightly run in the quarter reported success, and the line it reported is true. How many rows those runs exported is computed below." }, { "id": "639-the-pointer-was-aligned-and-the-struct-was-padded", "path": "/ai/examples/639-the-pointer-was-aligned-and-the-struct-was-padded.eml.md", "title": "The pointer was aligned and the struct was padded", "description": "`the_pointer_was_aligned_and_the_struct_was_padded.eml` - Every field in the record is correctly aligned and the compiler guarantees it. What the record costs is computed below." }, { "id": "640-the-replica-was-consistent-and-the-clock-was-ahead", "path": "/ai/examples/640-the-replica-was-consistent-and-the-clock-was-ahead.eml.md", "title": "The replica was consistent and the clock was ahead", "description": "`the_replica_was_consistent_and_the_clock_was_ahead.eml` - The replica has never diverged from the primary by a single row. How many sessions it ends early is computed below." }, { "id": "641-the-trigger-ran-inside-the-transaction-and-its-effect-did-not", "path": "/ai/examples/641-the-trigger-ran-inside-the-transaction-and-its-effect-did-not.eml.md", "title": "The trigger ran inside the transaction and its effect did not", "description": "`the_trigger_ran_inside_the_transaction_and_its_effect_did_not.eml` - The trigger runs inside the transaction, so it is rolled back with everything else. What was rolled back is computed below." }, { "id": "642-the-audit-log-was-append-only-and-the-reader-filtered", "path": "/ai/examples/642-the-audit-log-was-append-only-and-the-reader-filtered.eml.md", "title": "The audit log was append only and the reader filtered", "description": "`the_audit_log_was_append_only_and_the_reader_filtered.eml` - The audit log is append-only, hash-chained, and nothing has ever been removed from it. How much of it anybody has read is computed below." }, { "id": "643-the-build-was-reproducible-and-the-inputs-were-not-pinned", "path": "/ai/examples/643-the-build-was-reproducible-and-the-inputs-were-not-pinned.eml.md", "title": "The build was reproducible and the inputs were not pinned", "description": "`the_build_was_reproducible_and_the_inputs_were_not_pinned.eml` - Two independent builders produce byte-identical artifacts, every time. Whether two builds nine days apart agree is computed below." }, { "id": "644-the-column-was-not-null-and-the-value-was-an-empty-string", "path": "/ai/examples/644-the-column-was-not-null-and-the-value-was-an-empty-string.eml.md", "title": "The column was not null and the value was an empty string", "description": "`the_column_was_not_null_and_the_value_was_an_empty_string.eml` - The column is NOT NULL, the constraint has never been violated, and the database enforces it. How many rows carry a value is computed below." }, { "id": "645-the-counter-reset-at-midnight-and-the-shift-crossed-it", "path": "/ai/examples/645-the-counter-reset-at-midnight-and-the-shift-crossed-it.eml.md", "title": "The counter reset at midnight and the shift crossed it", "description": "`the_counter_reset_at_midnight_and_the_shift_crossed_it.eml` - The daily counter resets at midnight, which is what a daily counter does. When the page fires is computed below." }, { "id": "646-the-disk-had-space-and-the-inodes-did-not", "path": "/ai/examples/646-the-disk-had-space-and-the-inodes-did-not.eml.md", "title": "The disk had space and the inodes did not", "description": "`the_disk_had_space_and_the_inodes_did_not.eml` - The volume is thirty-eight percent free and the capacity dashboard is correct. Why writes are failing is computed below." }, { "id": "647-the-export-finished-and-the-import-saw-yesterday", "path": "/ai/examples/647-the-export-finished-and-the-import-saw-yesterday.eml.md", "title": "The export finished and the import saw yesterday", "description": "`the_export_finished_and_the_import_saw_yesterday.eml` - The export finishes every night and the import reads it every night, and both have run without error for four hundred and nineteen days. How old the data is is computed below." }, { "id": "648-the-fallback-was-tested-and-the-failover-was-not", "path": "/ai/examples/648-the-fallback-was-tested-and-the-failover-was-not.eml.md", "title": "The fallback was tested and the failover was not", "description": "`the_fallback_was_tested_and_the_failover_was_not.eml` - The fallback path is tested on every release and has never failed. How long an outage lasts is computed below." }, { "id": "649-the-index-was-rebuilt-and-the-statistics-were-not", "path": "/ai/examples/649-the-index-was-rebuilt-and-the-statistics-were-not.eml.md", "title": "The index was rebuilt and the statistics were not", "description": "`the_index_was_rebuilt_and_the_statistics_were_not.eml` - The index is rebuilt, unbloated and correct. How many queries use it is computed below." }, { "id": "650-the-lookup-was-cached-and-the-negative-result-was-not", "path": "/ai/examples/650-the-lookup-was-cached-and-the-negative-result-was-not.eml.md", "title": "The lookup was cached and the negative result was not", "description": "`the_lookup_was_cached_and_the_negative_result_was_not.eml` - The cache reports a ninety-nine point four percent hit rate and the number is correct. Where the database load comes from is computed below." }, { "id": "651-the-model-was-retrained-and-the-labels-came-from-the-old-one", "path": "/ai/examples/651-the-model-was-retrained-and-the-labels-came-from-the-old-one.eml.md", "title": "The model was retrained and the labels came from the old one", "description": "`the_model_was_retrained_and_the_labels_came_from_the_old_one.eml` - The model is retrained monthly on fresh data and its holdout accuracy is up again. What it got better at is computed below." }, { "id": "652-the-queue-was-durable-and-the-consumer-acked-first", "path": "/ai/examples/652-the-queue-was-durable-and-the-consumer-acked-first.eml.md", "title": "The queue was durable and the consumer acked first", "description": "`the_queue_was_durable_and_the_consumer_acked_first.eml` - The broker has never lost a message and its durability report is correct. How much work is lost is computed below." }, { "id": "653-the-request-was-authenticated-and-the-callback-was-not", "path": "/ai/examples/653-the-request-was-authenticated-and-the-callback-was-not.eml.md", "title": "The request was authenticated and the callback was not", "description": "`the_request_was_authenticated_and_the_callback_was_not.eml` - Every inbound request is authenticated and none has ever got through unsigned. What the outbound half proves is computed below." }, { "id": "654-the-timezone-was-stored-and-the-rule-changed", "path": "/ai/examples/654-the-timezone-was-stored-and-the-rule-changed.eml.md", "title": "The timezone was stored and the rule changed", "description": "`the_timezone_was_stored_and_the_rule_changed.eml` - Every event stores a UTC instant and its IANA zone name, which is the correct pair. How many future events are now an hour wrong is computed below." }, { "id": "655-the-two-nodes-agreed-and-both-were-behind", "path": "/ai/examples/655-the-two-nodes-agreed-and-both-were-behind.eml.md", "title": "The two nodes agreed and both were behind", "description": "`the_two_nodes_agreed_and_both_were_behind.eml` - Every read is confirmed by two replicas that agree, and they do agree. How old the answer is is computed below." }, { "id": "656-the-worker-restarted-and-the-poison-message-came-back", "path": "/ai/examples/656-the-worker-restarted-and-the-poison-message-came-back.eml.md", "title": "The worker restarted and the poison message came back", "description": "`the_worker_restarted_and_the_poison_message_came_back.eml` - The supervisor restarted the worker twelve hundred times this hour and every restart succeeded. How much work was done is computed below." }, { "id": "657-the-backup-was-encrypted-and-the-key-was-in-the-backup", "path": "/ai/examples/657-the-backup-was-encrypted-and-the-key-was-in-the-backup.eml.md", "title": "The backup was encrypted and the key was in the backup", "description": "`the_backup_was_encrypted_and_the_key_was_in_the_backup.eml` - Every backup is encrypted at rest and the restore drill passes quarterly. What an archive contains is computed below." }, { "id": "658-the-canary-was-healthy-and-it-served-the-easy-requests", "path": "/ai/examples/658-the-canary-was-healthy-and-it-served-the-easy-requests.eml.md", "title": "The canary was healthy and it served the easy requests", "description": "`the_canary_was_healthy_and_it_served_the_easy_requests.eml` - The canary took one percent of traffic for an hour and beat the baseline on every metric. What it was asked to do is computed below." }, { "id": "659-the-clock-was-monotonic-and-the-process-restarted", "path": "/ai/examples/659-the-clock-was-monotonic-and-the-process-restarted.eml.md", "title": "The clock was monotonic and the process restarted", "description": "`the_clock_was_monotonic_and_the_process_restarted.eml` - Durations use a monotonic clock, which is the correct choice and immune to every wall-clock hazard. How long a thirty-second lease lasts is computed below." }, { "id": "660-the-compression-was-lossless-and-the-schema-was-not", "path": "/ai/examples/660-the-compression-was-lossless-and-the-schema-was-not.eml.md", "title": "The compression was lossless and the schema was not", "description": "`the_compression_was_lossless_and_the_schema_was_not.eml` - Every archived byte comes back identical and ninety restores prove it. What cannot be recovered is computed below." }, { "id": "661-the-error-was-logged-and-the-caller-got-a-success-code", "path": "/ai/examples/661-the-error-was-logged-and-the-caller-got-a-success-code.eml.md", "title": "The error was logged and the caller got a success code", "description": "`the_error_was_logged_and_the_caller_got_a_success_code.eml` - The enrichment failure is caught, logged with a stack trace, and does not fail the request. What the caller can tell is computed below." }, { "id": "662-the-index-covered-the-query-and-the-sort-was-in-memory", "path": "/ai/examples/662-the-index-covered-the-query-and-the-sort-was-in-memory.eml.md", "title": "The index covered the query and the sort was in memory", "description": "`the_index_covered_the_query_and_the_sort_was_in_memory.eml` - The plan is an index-only scan with zero heap fetches, which is what the index was designed for. Where the time goes is computed below." }, { "id": "663-the-limit-was-per-user-and-the-attacker-had-many", "path": "/ai/examples/663-the-limit-was-per-user-and-the-attacker-had-many.eml.md", "title": "The limit was per user and the attacker had many", "description": "`the_limit_was_per_user_and_the_attacker_had_many.eml` - The rate limit is a hundred requests a minute per authenticated user and it has never been exceeded. What one actor can send is computed below." }, { "id": "664-the-migration-was-online-and-the-reads-took-a-lock", "path": "/ai/examples/664-the-migration-was-online-and-the-reads-took-a-lock.eml.md", "title": "The migration was online and the reads took a lock", "description": "`the_migration_was_online_and_the_reads_took_a_lock.eml` - The migration is online, took forty milliseconds, and rewrote nothing. How long the table was unavailable is computed below." }, { "id": "665-the-quota-renewed-monthly-and-the-billing-cycle-did-not", "path": "/ai/examples/665-the-quota-renewed-monthly-and-the-billing-cycle-did-not.eml.md", "title": "The quota renewed monthly and the billing cycle did not", "description": "`the_quota_renewed_monthly_and_the_billing_cycle_did_not.eml` - The quota resets on the first of each month and the customer never exceeded it. What the invoice charges for is computed below." }, { "id": "666-the-report-was-signed-off-and-the-query-changed", "path": "/ai/examples/666-the-report-was-signed-off-and-the-query-changed.eml.md", "title": "The report was signed off and the query changed", "description": "`the_report_was_signed_off_and_the_query_changed.eml` - Three people reviewed the quarterly report and signed it. What re-running it gives today is computed below." }, { "id": "667-the-schema-allowed-the-field-and-the-parser-ignored-it", "path": "/ai/examples/667-the-schema-allowed-the-field-and-the-parser-ignored-it.eml.md", "title": "The schema allowed the field and the parser ignored it", "description": "`the_schema_allowed_the_field_and_the_parser_ignored_it.eml` - The new field is in the schema, validates on every message, and is documented. How many consumers act on it is computed below." }, { "id": "668-the-secret-was-in-a-vault-and-the-process-list-was-not", "path": "/ai/examples/668-the-secret-was-in-a-vault-and-the-process-list-was-not.eml.md", "title": "The secret was in a vault and the process list was not", "description": "`the_secret_was_in_a_vault_and_the_process_list_was_not.eml` - No secret is in the source, the scanner proves it over forty-one thousand commits, and every one is fetched from a vault at boot. How many copies exist is computed below." }, { "id": "669-the-shard-key-was-uniform-and-the-traffic-was-not", "path": "/ai/examples/669-the-shard-key-was-uniform-and-the-traffic-was-not.eml.md", "title": "The shard key was uniform and the traffic was not", "description": "`the_shard_key_was_uniform_and_the_traffic_was_not.eml` - The shard key distributes forty million keys across sixty-four shards to within three parts in a thousand. What one shard serves is computed below." }, { "id": "670-the-token-was-refreshed-early-and-the-refresh-needed-the-old-one", "path": "/ai/examples/670-the-token-was-refreshed-early-and-the-refresh-needed-the-old-one.eml.md", "title": "The token was refreshed early and the refresh needed the old one", "description": "`the_token_was_refreshed_early_and_the_refresh_needed_the_old_one.eml` - The client refreshes five minutes before expiry, which is the right pattern. What happens on a client whose clock is wrong is computed below." }, { "id": "671-the-worker-scaled-with-the-queue-and-the-database-did-not", "path": "/ai/examples/671-the-worker-scaled-with-the-queue-and-the-database-did-not.eml.md", "title": "The worker scaled with the queue and the database did not", "description": "`the_worker_scaled_with_the_queue_and_the_database_did_not.eml` - The autoscaler scales workers on queue depth, which is the right signal, and it responded within a minute. How many of them can work is computed below." }, { "id": "672-the-average-was-weighted-and-the-weights-were-stale", "path": "/ai/examples/672-the-average-was-weighted-and-the-weights-were-stale.eml.md", "title": "The average was weighted and the weights were stale", "description": "`the_average_was_weighted_and_the_weights_were_stale.eml` - The fleet latency is a weighted average, which is the right shape, and the arithmetic is exact. What it reports is computed below." }, { "id": "673-the-batch-was-atomic-and-the-batches-were-not", "path": "/ai/examples/673-the-batch-was-atomic-and-the-batches-were-not.eml.md", "title": "The batch was atomic and the batches were not", "description": "`the_batch_was_atomic_and_the_batches_were_not.eml` - Each batch is a transaction and no batch has ever half-applied. What one interrupted run leaves behind is computed below." }, { "id": "674-the-benchmark-was-isolated-and-the-machine-was-shared", "path": "/ai/examples/674-the-benchmark-was-isolated-and-the-machine-was-shared.eml.md", "title": "The benchmark was isolated and the machine was shared", "description": "`the_benchmark_was_isolated_and_the_machine_was_shared.eml` - The benchmark pins a core, disables frequency scaling, warms the caches and reports a confidence interval of four parts in a thousand. What it measures is computed below." }, { "id": "675-the-cache-was-invalidated-and-the-cdn-was-not", "path": "/ai/examples/675-the-cache-was-invalidated-and-the-cdn-was-not.eml.md", "title": "The cache was invalidated and the cdn was not", "description": "`the_cache_was_invalidated_and_the_cdn_was_not.eml` - The application purges its cache on every write and the purge is verified within the request. What a user sees is computed below." }, { "id": "676-the-check-ran-on-commit-and-the-merge-was-a-squash", "path": "/ai/examples/676-the-check-ran-on-commit-and-the-merge-was-a-squash.eml.md", "title": "The check ran on commit and the merge was a squash", "description": "`the_check_ran_on_commit_and_the_merge_was_a_squash.eml` - Every commit on the branch was checked and every check passed. What was never checked is computed below." }, { "id": "677-the-column-was-dropped-and-the-cascade-took-the-view", "path": "/ai/examples/677-the-column-was-dropped-and-the-cascade-took-the-view.eml.md", "title": "The column was dropped and the cascade took the view", "description": "`the_column_was_dropped_and_the_cascade_took_the_view.eml` - Thirty-four repositories were searched for references to the column and none was found. What the drop removed is computed below." }, { "id": "678-the-diff-was-reviewed-and-the-generated-file-was-not", "path": "/ai/examples/678-the-diff-was-reviewed-and-the-generated-file-was-not.eml.md", "title": "The diff was reviewed and the generated file was not", "description": "`the_diff_was_reviewed_and_the_generated_file_was_not.eml` - Two people reviewed every line of the change and approved it. How many lines were in the change is computed below." }, { "id": "679-the-file-was-locked-and-the-copy-was-not", "path": "/ai/examples/679-the-file-was-locked-and-the-copy-was-not.eml.md", "title": "The file was locked and the copy was not", "description": "`the_file_was_locked_and_the_copy_was_not.eml` - Two writers can never interleave, the lock has held for three years, and no torn write has ever been observed. How many backups are torn is computed below." }, { "id": "680-the-log-had-the-request-id-and-the-worker-did-not", "path": "/ai/examples/680-the-log-had-the-request-id-and-the-worker-did-not.eml.md", "title": "The log had the request id and the worker did not", "description": "`the_log_had_the_request_id_and_the_worker_did_not.eml` - Every log line in the request path carries a correlation id and tracing across four services works. What share of the work is traceable is computed below." }, { "id": "681-the-parser-was-strict-and-the-generator-was-lenient", "path": "/ai/examples/681-the-parser-was-strict-and-the-generator-was-lenient.eml.md", "title": "The parser was strict and the generator was lenient", "description": "`the_parser_was_strict_and_the_generator_was_lenient.eml` - The parser rejects anything the specification does not require it to accept, deliberately. How many times that strictness has fired is computed below." }, { "id": "682-the-partition-was-dropped-and-the-query-scanned-it", "path": "/ai/examples/682-the-partition-was-dropped-and-the-query-scanned-it.eml.md", "title": "The partition was dropped and the query scanned it", "description": "`the_partition_was_dropped_and_the_query_scanned_it.eml` - Retention dropped three hundred and ten partitions and the query got four times faster. What it still scans is computed below." }, { "id": "683-the-permission-was-revoked-and-the-session-lived-on", "path": "/ai/examples/683-the-permission-was-revoked-and-the-session-lived-on.eml.md", "title": "The permission was revoked and the session lived on", "description": "`the_permission_was_revoked_and_the_session_lived_on.eml` - A revocation propagates in forty milliseconds and the offboarding target is fifteen minutes. How long the access lasts is computed below." }, { "id": "684-the-schema-was-strict-and-the-defaults-filled-it-in", "path": "/ai/examples/684-the-schema-was-strict-and-the-defaults-filled-it-in.eml.md", "title": "The schema was strict and the defaults filled it in", "description": "`the_schema_was_strict_and_the_defaults_filled_it_in.eml` - The configuration is validated against a strict schema and has never failed validation. How much of it anybody chose is computed below." }, { "id": "685-the-shutdown-was-graceful-and-the-signal-went-to-the-wrapper", "path": "/ai/examples/685-the-shutdown-was-graceful-and-the-signal-went-to-the-wrapper.eml.md", "title": "The shutdown was graceful and the signal went to the wrapper", "description": "`the_shutdown_was_graceful_and_the_signal_went_to_the_wrapper.eml` - The process handles the termination signal, drains in six seconds, and fourteen tests cover it. How many requests are killed per deploy is computed below." }, { "id": "686-the-value-was-validated-on-the-client-and-trusted-on-the-server", "path": "/ai/examples/686-the-value-was-validated-on-the-client-and-trusted-on-the-server.eml.md", "title": "The value was validated on the client and trusted on the server", "description": "`the_value_was_validated_on_the_client_and_trusted_on_the_server.eml` - The client checks every field before submitting and catches twenty-six thousand bad inputs a day. How many submissions reach the server unchecked is computed below." }, { "id": "687-the-allocation-was-pooled-and-the-fragmentation-was-not", "path": "/ai/examples/687-the-allocation-was-pooled-and-the-fragmentation-was-not.eml.md", "title": "The allocation was pooled and the fragmentation was not", "description": "`the_allocation_was_pooled_and_the_fragmentation_was_not.eml` - The object pool cut allocations by ninety-eight percent and the measurement is right. What resident memory did is computed below." }, { "id": "688-the-audit-covered-every-table-and-the-view-was-not-a-table", "path": "/ai/examples/688-the-audit-covered-every-table-and-the-view-was-not-a-table.eml.md", "title": "The audit covered every table and the view was not a table", "description": "`the_audit_covered_every_table_and_the_view_was_not_a_table.eml` - Every table in the database is covered by the access audit and the coverage is enumerated rather than asserted. What is not covered is computed below." }, { "id": "689-the-checksum-covered-the-plaintext-and-the-archive-kept-the-compressed", "path": "/ai/examples/689-the-checksum-covered-the-plaintext-and-the-archive-kept-the-compressed.eml.md", "title": "The checksum covered the plaintext and the archive kept the compressed", "description": "`the_checksum_covered_the_plaintext_and_the_archive_kept_the_compressed.eml` - The digest is computed over the plaintext before compression and verified after decompression, end to end. What the storage migration verified is computed below." }, { "id": "690-the-config-was-per-environment-and-the-secret-was-shared", "path": "/ai/examples/690-the-config-was-per-environment-and-the-secret-was-shared.eml.md", "title": "The config was per environment and the secret was shared", "description": "`the_config_was_per_environment_and_the_secret_was_shared.eml` - Three environments have three configuration files and forty-nine of fifty-two keys differ between them. What the three identical keys are is computed below." }, { "id": "691-the-crontab-was-utc-and-the-report-was-local", "path": "/ai/examples/691-the-crontab-was-utc-and-the-report-was-local.eml.md", "title": "The crontab was utc and the report was local", "description": "`the_crontab_was_utc_and_the_report_was_local.eml` - The scheduler runs in UTC, which is the right choice and was made deliberately. What the daily report covers is computed below." }, { "id": "692-the-dependency-was-optional-and-the-import-was-at-the-top", "path": "/ai/examples/692-the-dependency-was-optional-and-the-import-was-at-the-top.eml.md", "title": "The dependency was optional and the import was at the top", "description": "`the_dependency_was_optional_and_the_import_was_at_the_top.eml` - The feature checks whether its optional dependency is available before using it, in seven places, and every check is correct. How many of those checks run is computed below." }, { "id": "693-the-encryption-was-end-to-end-and-the-metadata-was-not", "path": "/ai/examples/693-the-encryption-was-end-to-end-and-the-metadata-was-not.eml.md", "title": "The encryption was end to end and the metadata was not", "description": "`the_encryption_was_end_to_end_and_the_metadata_was_not.eml` - The server cannot read a single message body and the cryptography is not the weak part. What the server does hold is computed below." }, { "id": "694-the-fix-was-behind-a-flag-and-the-flag-was-read-once", "path": "/ai/examples/694-the-fix-was-behind-a-flag-and-the-flag-was-read-once.eml.md", "title": "The fix was behind a flag and the flag was read once", "description": "`the_fix_was_behind_a_flag_and_the_flag_was_read_once.eml` - The fix is behind a flag and the flag service propagates a change in thirty seconds. How long turning it on takes is computed below." }, { "id": "695-the-form-was-accessible-and-the-error-was-a-colour", "path": "/ai/examples/695-the-form-was-accessible-and-the-error-was-a-colour.eml.md", "title": "The form was accessible and the error was a colour", "description": "`the_form_was_accessible_and_the_error_was_a_colour.eml` - The form passes every automated accessibility check, a hundred and forty-eight of them. How a user is told a field is wrong is computed below." }, { "id": "696-the-hash-was-salted-and-the-salt-was-constant", "path": "/ai/examples/696-the-hash-was-salted-and-the-salt-was-constant.eml.md", "title": "The hash was salted and the salt was constant", "description": "`the_hash_was_salted_and_the_salt_was_constant.eml` - Passwords are salted and stretched with a tuned work factor, and no password is stored. How many users share a stored value is computed below." }, { "id": "697-the-limit-was-on-concurrency-and-the-work-was-queued", "path": "/ai/examples/697-the-limit-was-on-concurrency-and-the-work-was-queued.eml.md", "title": "The limit was on concurrency and the work was queued", "description": "`the_limit_was_on_concurrency_and_the_work_was_queued.eml` - The downstream never sees more than thirty-two concurrent requests and it never has. What a caller waits is computed below." }, { "id": "698-the-numbers-were-anonymised-and-the-combination-was-unique", "path": "/ai/examples/698-the-numbers-were-anonymised-and-the-combination-was-unique.eml.md", "title": "The numbers were anonymised and the combination was unique", "description": "`the_numbers_were_anonymised_and_the_combination_was_unique.eml` - Every direct identifier was removed and the removal was verified field by field. How many records identify one person is computed below." }, { "id": "699-the-page-was-server-rendered-and-the-price-was-client-side", "path": "/ai/examples/699-the-page-was-server-rendered-and-the-price-was-client-side.eml.md", "title": "The page was server rendered and the price was client side", "description": "`the_page_was_server_rendered_and_the_price_was_client_side.eml` - The page is rendered on the server and arrives complete, which the performance work measured and confirmed. Where the price comes from is computed below." }, { "id": "700-the-rollout-was-gradual-and-the-write-was-not", "path": "/ai/examples/700-the-rollout-was-gradual-and-the-write-was-not.eml.md", "title": "The rollout was gradual and the write was not", "description": "`the_rollout_was_gradual_and_the_write_was_not.eml` - The feature is on for five percent of users behind a kill switch that has been exercised. How many users are exposed to it is computed below." }, { "id": "701-the-search-index-was-fresh-and-the-permissions-were-cached", "path": "/ai/examples/701-the-search-index-was-fresh-and-the-permissions-were-cached.eml.md", "title": "The search index was fresh and the permissions were cached", "description": "`the_search_index_was_fresh_and_the_permissions_were_cached.eml` - A document is searchable two seconds after it is written and the freshness is measured continuously. How old the access rules in the index are is computed below." }, { "id": "702-the-callback-was-registered-and-the-object-was-collected", "path": "/ai/examples/702-the-callback-was-registered-and-the-object-was-collected.eml.md", "title": "The callback was registered and the object was collected", "description": "`the_callback_was_registered_and_the_object_was_collected.eml` - The event registry is typed, tested, and delivers every event it dispatches with no recorded failures. What the delivery rate is a rate over is computed below." }, { "id": "703-the-consent-was-recorded-and-the-purpose-was-not", "path": "/ai/examples/703-the-consent-was-recorded-and-the-purpose-was-not.eml.md", "title": "The consent was recorded and the purpose was not", "description": "`the_consent_was_recorded_and_the_purpose_was_not.eml` - Consent is recorded for every subject, versioned, timestamped and revocable, and an audit sample reconciled completely. How much processing it covers is computed below." }, { "id": "704-the-cursor-was-stable-and-the-filter-changed", "path": "/ai/examples/704-the-cursor-was-stable-and-the-filter-changed.eml.md", "title": "The cursor was stable and the filter changed", "description": "`the_cursor_was_stable_and_the_filter_changed.eml` - Keyset pagination returns no duplicates and skips no row, which offset pagination did both of. How many rows a full scan misses is computed below." }, { "id": "705-the-endpoint-was-versioned-and-the-error-shape-was-not", "path": "/ai/examples/705-the-endpoint-was-versioned-and-the-error-shape-was-not.eml.md", "title": "The endpoint was versioned and the error shape was not", "description": "`the_endpoint_was_versioned_and_the_error_shape_was_not.eml` - The API is versioned with discipline and no success schema has broken outside a major bump in three years. What is outside the version is computed below." }, { "id": "706-the-image-was-scanned-at-build-and-the-advisories-arrived-later", "path": "/ai/examples/706-the-image-was-scanned-at-build-and-the-advisories-arrived-later.eml.md", "title": "The image was scanned at build and the advisories arrived later", "description": "`the_image_was_scanned_at_build_and_the_advisories_arrived_later.eml` - Every image is scanned before it can be pushed and eleven builds were blocked this quarter. How many running images carry a known advisory is computed below." }, { "id": "707-the-index-was-unique-and-the-writes-were-in-two-regions", "path": "/ai/examples/707-the-index-was-unique-and-the-writes-were-in-two-regions.eml.md", "title": "The index was unique and the writes were in two regions", "description": "`the_index_was_unique_and_the_writes_were_in_two_regions.eml` - Uniqueness is a database constraint rather than an application check, and it has rejected every duplicate it saw. Where it is evaluated is computed below." }, { "id": "708-the-quota-was-checked-at-submit-and-spent-at-run", "path": "/ai/examples/708-the-quota-was-checked-at-submit-and-spent-at-run.eml.md", "title": "The quota was checked at submit and spent at run", "description": "`the_quota_was_checked_at_submit_and_spent_at_run.eml` - Every job is checked against its tenant's remaining budget before it is accepted, and no submission has bypassed the check. What the check compares is computed below." }, { "id": "709-the-refactor-preserved-behaviour-and-the-timing-was-behaviour", "path": "/ai/examples/709-the-refactor-preserved-behaviour-and-the-timing-was-behaviour.eml.md", "title": "The refactor preserved behaviour and the timing was behaviour", "description": "`the_refactor_preserved_behaviour_and_the_timing_was_behaviour.eml` - A refactor was validated by replaying millions of production inputs through both implementations. What the replay compared is computed below." }, { "id": "710-the-review-caught-the-bug-and-the-revert-was-partial", "path": "/ai/examples/710-the-review-caught-the-bug-and-the-revert-was-partial.eml.md", "title": "The review caught the bug and the revert was partial", "description": "`the_review_caught_the_bug_and_the_revert_was_partial.eml` - A reviewer found the defect, the author agreed, and the commit was reverted cleanly before release. What the revert removed is computed below." }, { "id": "711-the-sample-was-stratified-and-the-strata-were-stale", "path": "/ai/examples/711-the-sample-was-stratified-and-the-strata-were-stale.eml.md", "title": "The sample was stratified and the strata were stale", "description": "`the_sample_was_stratified_and_the_strata_were_stale.eml` - The quality sample is stratified with proportional allocation and weighted estimation, reviewed by a statistician. What the weights reconstruct is computed below." }, { "id": "712-the-test-used-a-fixed-seed-and-the-library-changed-its-generator", "path": "/ai/examples/712-the-test-used-a-fixed-seed-and-the-library-changed-its-generator.eml.md", "title": "The test used a fixed seed and the library changed its generator", "description": "`the_test_used_a_fixed_seed_and_the_library_changed_its_generator.eml` - Every test seeds the generator, so every failure reproduces and the flaky-test problem is gone. What the suite has actually explored is computed below." }, { "id": "713-the-total-was-checked-and-the-currencies-were-mixed", "path": "/ai/examples/713-the-total-was-checked-and-the-currencies-were-mixed.eml.md", "title": "The total was checked and the currencies were mixed", "description": "`the_total_was_checked_and_the_currencies_were_mixed.eml` - Every invoice is reconciled nightly against the sum of its lines, in exact integer arithmetic, and no invoice mismatches. What the sum is a sum of is computed below." }, { "id": "714-the-two-writers-used-the-same-key-and-different-clocks", "path": "/ai/examples/714-the-two-writers-used-the-same-key-and-different-clocks.eml.md", "title": "The two writers used the same key and different clocks", "description": "`the_two_writers_used_the_same_key_and_different_clocks.eml` - Conflicts resolve deterministically by last-write-wins and both hosts run a disciplined clock. How often the later write loses is computed below." }, { "id": "715-the-user-was-deleted-and-the-backup-had-them", "path": "/ai/examples/715-the-user-was-deleted-and-the-backup-had-them.eml.md", "title": "The user was deleted and the backup had them", "description": "`the_user_was_deleted_and_the_backup_had_them.eml` - Erasure cascades across every table and a post-deletion probe confirms zero rows remain. Which stores the probe reads is computed below." }, { "id": "716-the-worker-was-stateless-and-the-filesystem-was-not", "path": "/ai/examples/716-the-worker-was-stateless-and-the-filesystem-was-not.eml.md", "title": "The worker was stateless and the filesystem was not", "description": "`the_worker_was_stateless_and_the_filesystem_was_not.eml` - The workers hold no session state, any request can go to any pod, and a chaos test kills one every five minutes without a failed request. What persists is computed below." }, { "id": "717-the-backup-was-tested-and-the-restore-was-to-an-empty-cluster", "path": "/ai/examples/717-the-backup-was-tested-and-the-restore-was-to-an-empty-cluster.eml.md", "title": "The backup was tested and the restore was to an empty cluster", "description": "`the_backup_was_tested_and_the_restore_was_to_an_empty_cluster.eml` - Backups are not merely taken, they are restored weekly and the restored copy is checksummed, counted and smoke-tested. Which recovery that rehearses is computed below." }, { "id": "718-the-cache-was-keyed-on-the-url-and-the-header-varied-the-answer", "path": "/ai/examples/718-the-cache-was-keyed-on-the-url-and-the-header-varied-the-answer.eml.md", "title": "The cache was keyed on the url and the header varied the answer", "description": "`the_cache_was_keyed_on_the_url_and_the_header_varied_the_answer.eml` - The cache key is the full URL with query parameters sorted and allowlisted, the hit rate is ninety-four percent, and purges on deploy are verified. What the key omits is computed below." }, { "id": "719-the-contract-was-generated-and-the-server-was-both-parties", "path": "/ai/examples/719-the-contract-was-generated-and-the-server-was-both-parties.eml.md", "title": "The contract was generated and the server was both parties", "description": "`the_contract_was_generated_and_the_server_was_both_parties.eml` - Every endpoint has a contract test, the contract is generated so it cannot drift from the code, and twenty-three client repositories test against a mock built from it. Who authored the expectations is computed below." }, { "id": "720-the-dashboard-was-real-time-and-the-pipeline-was-hourly", "path": "/ai/examples/720-the-dashboard-was-real-time-and-the-pipeline-was-hourly.eml.md", "title": "The dashboard was real time and the pipeline was hourly", "description": "`the_dashboard_was_real_time_and_the_pipeline_was_hourly.eml` - The dashboard refreshes every five seconds over a push connection and shows when it last updated. What that timestamp is the age of is computed below." }, { "id": "721-the-licence-was-checked-at-install-and-the-machine-was-cloned", "path": "/ai/examples/721-the-licence-was-checked-at-install-and-the-machine-was-cloned.eml.md", "title": "The licence was checked at install and the machine was cloned", "description": "`the_licence_was_checked_at_install_and_the_machine_was_cloned.eml` - The licence file is signed, verified against a public key at install, bound to a hardware fingerprint, and the installer refuses without a valid one. How many running machines verified it is computed below." }, { "id": "722-the-limit-was-on-the-upload-and-the-cost-was-after-decompression", "path": "/ai/examples/722-the-limit-was-on-the-upload-and-the-cost-was-after-decompression.eml.md", "title": "The limit was on the upload and the cost was after decompression", "description": "`the_limit_was_on_the_upload_and_the_cost_was_after_decompression.eml` - The upload limit is enforced at the edge while the body streams, so an oversized request is refused without being buffered. What the limit is a limit on is computed below." }, { "id": "723-the-migration-ran-forward-and-the-code-deployed-first", "path": "/ai/examples/723-the-migration-ran-forward-and-the-code-deployed-first.eml.md", "title": "The migration ran forward and the code deployed first", "description": "`the_migration_ran_forward_and_the_code_deployed_first.eml` - Every migration is expand-contract, reviewed, run by CI against a copy of production, and none has needed downtime or a rollback. What runs during the deploy is computed below." }, { "id": "724-the-permission-was-inherited-and-the-link-bypassed-the-parent", "path": "/ai/examples/724-the-permission-was-inherited-and-the-link-bypassed-the-parent.eml.md", "title": "The permission was inherited and the link bypassed the parent", "description": "`the_permission_was_inherited_and_the_link_bypassed_the_parent.eml` - Access is decided server-side by walking to the parent folder, with no client-side hiding, and a red team found no way past it. What that walk decides is computed below." }, { "id": "725-the-plan-was-empty-and-the-state-file-was-the-comparison", "path": "/ai/examples/725-the-plan-was-empty-and-the-state-file-was-the-comparison.eml.md", "title": "The plan was empty and the state file was the comparison", "description": "`the_plan_was_empty_and_the_state_file_was_the_comparison.eml` - Infrastructure is declarative, every change is reviewed as a plan, and a nightly job alerts on any plan that is not empty. What the plan compares is computed below." }, { "id": "726-the-queue-was-ordered-and-the-consumers-were-parallel", "path": "/ai/examples/726-the-queue-was-ordered-and-the-consumers-were-parallel.eml.md", "title": "The queue was ordered and the consumers were parallel", "description": "`the_queue_was_ordered_and_the_consumers_were_parallel.eml` - The log is ordered per partition and the producer partitions by entity, so every event for one entity arrives in order. What happens after arrival is computed below." }, { "id": "727-the-runbook-was-followed-and-the-topology-had-changed", "path": "/ai/examples/727-the-runbook-was-followed-and-the-topology-had-changed.eml.md", "title": "The runbook was followed and the topology had changed", "description": "`the_runbook_was_followed_and_the_topology_had_changed.eml` - The runbook was written after a real incident, drilled, and used successfully twenty-three times. How much of it still describes the system is computed below." }, { "id": "728-the-span-was-traced-and-the-async-boundary-lost-the-context", "path": "/ai/examples/728-the-span-was-traced-and-the-async-boundary-lost-the-context.eml.md", "title": "The span was traced and the async boundary lost the context", "description": "`the_span_was_traced_and_the_async_boundary_lost_the_context.eml` - Every service is instrumented, trace context crosses every HTTP hop, errors are sampled at a hundred percent, and the traces have found real latency problems. What a trace covers is computed below." }, { "id": "729-the-tests-were-parallel-and-the-fixture-was-shared", "path": "/ai/examples/729-the-tests-were-parallel-and-the-fixture-was-shared.eml.md", "title": "The tests were parallel and the fixture was shared", "description": "`the_tests_were_parallel_and_the_fixture_was_shared.eml` - Every test runs inside a transaction that is rolled back afterwards, so no test can see another's rows. What a rollback restores is computed below." }, { "id": "730-the-timeout-was-set-and-the-pool-had-its-own", "path": "/ai/examples/730-the-timeout-was-set-and-the-pool-had-its-own.eml.md", "title": "The timeout was set and the pool had its own", "description": "`the_timeout_was_set_and_the_pool_had_its_own.eml` - Every outbound call has an explicit timeout and a lint rule fails the build without one. What that timeout bounds is computed below." }, { "id": "731-the-vendor-was-audited-and-the-subprocessor-was-not", "path": "/ai/examples/731-the-vendor-was-audited-and-the-subprocessor-was-not.eml.md", "title": "The vendor was audited and the subprocessor was not", "description": "`the_vendor_was_audited_and_the_subprocessor_was_not.eml` - Every vendor is audited annually, the reports are read rather than filed, and two vendors were rejected on the strength of it. How far the audit reaches is computed below." }, { "id": "732-each-job-fit-in-memory-and-eight-ran-at-once", "path": "/ai/examples/732-each-job-fit-in-memory-and-eight-ran-at-once.eml.md", "title": "Each job fit in memory and eight ran at once", "description": "`each_job_fit_in_memory_and_eight_ran_at_once.eml` - Every report job has a measured memory cap asserted in CI against a real run, and none has ever exceeded it. What the host is asked for is computed below." }, { "id": "733-the-breaker-was-per-instance-and-the-dependency-was-shared", "path": "/ai/examples/733-the-breaker-was-per-instance-and-the-dependency-was-shared.eml.md", "title": "The breaker was per instance and the dependency was shared", "description": "`the_breaker_was_per_instance_and_the_dependency_was_shared.eml` - The circuit breaker is per dependency, trips on consecutive failures, probes with a single half-open call, and it demonstrably shed load during a real outage. Where it lives is computed below." }, { "id": "734-the-budget-alert-was-on-spend-and-the-commitment-was-on-capacity", "path": "/ai/examples/734-the-budget-alert-was-on-spend-and-the-commitment-was-on-capacity.eml.md", "title": "The budget alert was on spend and the commitment was on capacity", "description": "`the_budget_alert_was_on_spend_and_the_commitment_was_on_capacity.eml` - Budget alerts are configured at two thresholds, tested with a real charge, and routed to a person who acknowledges them. What they can move with is computed below." }, { "id": "735-the-comparison-had-a-control-group-on-the-same-build", "path": "/ai/examples/735-the-comparison-had-a-control-group-on-the-same-build.eml.md", "title": "The comparison had a control group on the same build", "description": "`the_comparison_had_a_control_group_on_the_same_build.eml` - Every deploy runs a canary analysis against a control group across forty-one metrics and it has rolled back seven real regressions. What the two groups differ in is computed below." }, { "id": "736-the-crash-reporter-was-installed-and-the-worst-crashes-took-it-too", "path": "/ai/examples/736-the-crash-reporter-was-installed-and-the-worst-crashes-took-it-too.eml.md", "title": "The crash reporter was installed and the worst crashes took it too", "description": "`the_crash_reporter_was_installed_and_the_worst_crashes_took_it_too.eml` - The crash reporter ships in every build, symbolicates, deduplicates by stack, and the top five crashes it ranked were found and fixed. What it can report is computed below." }, { "id": "737-the-inventory-was-built-from-the-agents-that-checked-in", "path": "/ai/examples/737-the-inventory-was-built-from-the-agents-that-checked-in.eml.md", "title": "The inventory was built from the agents that checked in", "description": "`the_inventory_was_built_from_the_agents_that_checked_in.eml` - The asset inventory refreshes hourly from a reporting agent, shows full agent coverage, and found forty-one unpatched hosts. Where its host list comes from is computed below." }, { "id": "738-the-limit-was-in-rows-and-the-cost-was-in-bytes", "path": "/ai/examples/738-the-limit-was-in-rows-and-the-cost-was-in-bytes.eml.md", "title": "The limit was in rows and the cost was in bytes", "description": "`the_limit_was_in_rows_and_the_cost_was_in_bytes.eml` - The export endpoint caps a result at ten thousand rows, enforced in the query rather than after it, and there is no way to ask for more. What ten thousand rows weigh is computed below." }, { "id": "739-the-policy-applied-at-admission-and-the-old-resources-stayed", "path": "/ai/examples/739-the-policy-applied-at-admission-and-the-old-resources-stayed.eml.md", "title": "The policy applied at admission and the old resources stayed", "description": "`the_policy_applied_at_admission_and_the_old_resources_stayed.eml` - A policy engine sits in the admission path, refuses non-compliant resources rather than reporting them, has no exemption mechanism, and has blocked nineteen hundred creations. Which resources it has seen is computed below." }, { "id": "740-the-progress-counted-files-and-the-work-was-in-one-of-them", "path": "/ai/examples/740-the-progress-counted-files-and-the-work-was-in-one-of-them.eml.md", "title": "The progress counted files and the work was in one of them", "description": "`the_progress_counted_files_and_the_work_was_in_one_of_them.eml` - The migration shows a progress bar that updates after every file, never goes backwards, and reports exactly what it has finished. What it is a fraction of is computed below." }, { "id": "741-the-query-was-under-the-threshold-and-the-page-made-three-hundred", "path": "/ai/examples/741-the-query-was-under-the-threshold-and-the-page-made-three-hundred.eml.md", "title": "The query was under the threshold and the page made three hundred", "description": "`the_query_was_under_the_threshold_and_the_page_made_three_hundred.eml` - The slow-query log has a fifty millisecond threshold and has not recorded an entry in a month. What one page render costs is computed below." }, { "id": "742-the-reconciliation-was-run-by-the-copier", "path": "/ai/examples/742-the-reconciliation-was-run-by-the-copier.eml.md", "title": "The reconciliation was run by the copier", "description": "`the_reconciliation_was_run_by_the_copier.eml` - A nightly reconciliation compares the operational database to the warehouse and has reported no discrepancy in two years. Which two things it compares is computed below." }, { "id": "743-the-retention-was-promised-in-days-and-the-buffer-held-events", "path": "/ai/examples/743-the-retention-was-promised-in-days-and-the-buffer-held-events.eml.md", "title": "The retention was promised in days and the buffer held events", "description": "`the_retention_was_promised_in_days_and_the_buffer_held_events.eml` - The log retention policy says thirty days, is written down, is cited in three audits, and the store enforces it. What the store enforces is computed below." }, { "id": "744-the-sandbox-blocked-the-network-and-the-lookup-was-the-channel", "path": "/ai/examples/744-the-sandbox-blocked-the-network-and-the-lookup-was-the-channel.eml.md", "title": "The sandbox blocked the network and the lookup was the channel", "description": "`the_sandbox_blocked_the_network_and_the_lookup_was_the_channel.eml` - The build sandbox denies outbound network by default, the denial is asserted by a test rather than assumed, and it caught two dependencies calling home. What remains reachable is computed below." }, { "id": "745-the-signature-was-verified-and-the-parser-ran-first", "path": "/ai/examples/745-the-signature-was-verified-and-the-parser-ran-first.eml.md", "title": "The signature was verified and the parser ran first", "description": "`the_signature_was_verified_and_the_parser_ran_first.eml` - Every webhook verifies an HMAC with a constant-time compare, inside a replay window, against a rotated secret. Where in the request path that happens is computed below." }, { "id": "746-the-sla-counted-responses-and-the-answers-were-wrong", "path": "/ai/examples/746-the-sla-counted-responses-and-the-answers-were-wrong.eml.md", "title": "The sla counted responses and the answers were wrong", "description": "`the_sla_counted_responses_and_the_answers_were_wrong.eml` - Availability is measured from twelve regions every thirty seconds and from the real error rate, and credits were paid the two times it was missed. What counts as available is computed below." }, { "id": "747-each-region-had-headroom-and-the-failover-chose-one", "path": "/ai/examples/747-each-region-had-headroom-and-the-failover-chose-one.eml.md", "title": "Each region had headroom and the failover chose one", "description": "`each_region_had_headroom_and_the_failover_chose_one.eml` - Every region runs at sixty percent and the capacity plan requires forty percent headroom in each, checked weekly. What a failover asks for is computed below." }, { "id": "748-the-accuracy-was-measured-where-the-model-was-confident", "path": "/ai/examples/748-the-accuracy-was-measured-where-the-model-was-confident.eml.md", "title": "The accuracy was measured where the model was confident", "description": "`the_accuracy_was_measured_where_the_model_was_confident.eml` - The classifier abstains below a confidence threshold rather than guessing, and on what it does answer it is right 99.4 percent of the time. What that rate is over is computed below." }, { "id": "749-the-approval-was-required-above-a-diff-size", "path": "/ai/examples/749-the-approval-was-required-above-a-diff-size.eml.md", "title": "The approval was required above a diff size", "description": "`the_approval_was_required_above_a_diff_size.eml` - A change above two hundred lines needs a second approver from another team, enforced in the pipeline, and that review has found twelve real problems. Which changes it sees is computed below." }, { "id": "750-the-backlog-was-counted-in-items-and-the-items-grew", "path": "/ai/examples/750-the-backlog-was-counted-in-items-and-the-items-grew.eml.md", "title": "The backlog was counted in items and the items grew", "description": "`the_backlog_was_counted_in_items_and_the_items_grew.eml` - The backlog is tracked as a count of unprocessed items, charted daily, and it has been flat for a year. What a flat count means is computed below." }, { "id": "751-the-capacity-was-sold-in-seats-and-the-load-arrived-in-sessions", "path": "/ai/examples/751-the-capacity-was-sold-in-seats-and-the-load-arrived-in-sessions.eml.md", "title": "The capacity was sold in seats and the load arrived in sessions", "description": "`the_capacity_was_sold_in_seats_and_the_load_arrived_in_sessions.eml` - Capacity is planned from seats sold, the model was fitted against two years of measured load, and it has predicted the last six months within four percent. What a seat is a proxy for is computed below." }, { "id": "752-the-changelog-listed-the-merges-and-a-revert-is-a-merge", "path": "/ai/examples/752-the-changelog-listed-the-merges-and-a-revert-is-a-merge.eml.md", "title": "The changelog listed the merges and a revert is a merge", "description": "`the_changelog_listed_the_merges_and_a_revert_is_a_merge.eml` - The changelog is generated from merged pull requests rather than written by hand, so nothing that shipped is missing from it. What \"shipped\" means to the generator is computed below." }, { "id": "753-the-dependencies-were-pinned-and-the-transitive-set-was-resolved", "path": "/ai/examples/753-the-dependencies-were-pinned-and-the-transitive-set-was-resolved.eml.md", "title": "The dependencies were pinned and the transitive set was resolved", "description": "`the_dependencies_were_pinned_and_the_transitive_set_was_resolved.eml` - Every direct dependency is pinned to an exact version, reviewed on change, and the build fails on a range. How much of the tree that fixes is computed below." }, { "id": "754-the-feedback-widget-was-on-the-page-that-helped", "path": "/ai/examples/754-the-feedback-widget-was-on-the-page-that-helped.eml.md", "title": "The feedback widget was on the page that helped", "description": "`the_feedback_widget_was_on_the_page_that_helped.eml` - Every help article ends with \"was this useful?\", the responses are stored with the article and the query that led there, and 94 percent say yes. Who answers is computed below." }, { "id": "755-the-integrity-check-read-the-backups-own-manifest", "path": "/ai/examples/755-the-integrity-check-read-the-backups-own-manifest.eml.md", "title": "The integrity check read the backups own manifest", "description": "`the_integrity_check_read_the_backups_own_manifest.eml` - Every backup is verified rather than assumed: each file's checksum is recomputed after upload and the count is compared against the manifest, which caught three truncated uploads. What the manifest is a list of is computed below." }, { "id": "756-the-key-was-rotated-and-the-old-key-was-still-required", "path": "/ai/examples/756-the-key-was-rotated-and-the-old-key-was-still-required.eml.md", "title": "The key was rotated and the old key was still required", "description": "`the_key_was_rotated_and_the_old_key_was_still_required.eml` - Encryption keys rotate every ninety days, automatically, verified by a canary decrypt after each rotation, with no failed decrypts in eight rotations. What rotation changes is computed below." }, { "id": "757-the-migration-ran-on-the-primary-and-the-replica-had-its-own-queue", "path": "/ai/examples/757-the-migration-ran-on-the-primary-and-the-replica-had-its-own-queue.eml.md", "title": "The migration ran on the primary and the replica had its own queue", "description": "`the_migration_ran_on_the_primary_and_the_replica_had_its_own_queue.eml` - Schema changes use an online tool that never takes a table lock, and three hundred and forty have run with no downtime. Where \"no downtime\" was measured is computed below." }, { "id": "758-the-probe-ran-inside-the-container-and-the-sidecar-was-the-dependency", "path": "/ai/examples/758-the-probe-ran-inside-the-container-and-the-sidecar-was-the-dependency.eml.md", "title": "The probe ran inside the container and the sidecar was the dependency", "description": "`the_probe_ran_inside_the_container_and_the_sidecar_was_the_dependency.eml` - The liveness probe executes inside the container, exercises a real code path rather than a static handler, and has restarted forty-one genuinely wedged processes. What it can observe is computed below." }, { "id": "759-the-queue-age-was-measured-on-what-was-still-queued", "path": "/ai/examples/759-the-queue-age-was-measured-on-what-was-still-queued.eml.md", "title": "The queue age was measured on what was still queued", "description": "`the_queue_age_was_measured_on_what_was_still_queued.eml` - The queue's oldest message is sampled every ten seconds and pages above five minutes, and it has caught eleven real stalls. What it can report is computed below." }, { "id": "760-the-quota-was-enforced-at-the-gateway-and-the-caller-was-internal", "path": "/ai/examples/760-the-quota-was-enforced-at-the-gateway-and-the-caller-was-internal.eml.md", "title": "The quota was enforced at the gateway and the caller was internal", "description": "`the_quota_was_enforced_at_the_gateway_and_the_caller_was_internal.eml` - Per-tenant quotas are enforced at the gateway with no bypass header and no exempt caller, and they refuse nine thousand four hundred requests a day. Which requests reach the gateway is computed below." }, { "id": "761-the-rotation-covered-the-services-in-the-registry", "path": "/ai/examples/761-the-rotation-covered-the-services-in-the-registry.eml.md", "title": "The rotation covered the services in the registry", "description": "`the_rotation_covered_the_services_in_the_registry.eml` - Every service in the registry has a named on-call rotation with a tested escalation path, and no page has gone unanswered in fourteen months. Which services are in the registry is computed below." }, { "id": "762-the-alert-was-tested-by-firing-it-and-the-delivery-was-not", "path": "/ai/examples/762-the-alert-was-tested-by-firing-it-and-the-delivery-was-not.eml.md", "title": "The alert was tested by firing it and the delivery was not", "description": "`the_alert_was_tested_by_firing_it_and_the_delivery_was_not.eml` - Alert rules are tested rather than trusted: a synthetic metric is injected, the rule is expected to fire, and a rule that does not fire fails the build. Where the test stops is computed below." }, { "id": "763-the-books-balanced-and-the-difference-went-to-suspense", "path": "/ai/examples/763-the-books-balanced-and-the-difference-went-to-suspense.eml.md", "title": "The books balanced and the difference went to suspense", "description": "`the_books_balanced_and_the_difference_went_to_suspense.eml` - The daily reconciliation between the processor's settlement file and the internal ledger has balanced to the cent every day for four years. What balancing consists of is computed below." }, { "id": "764-the-count-was-of-users-and-the-identity-was-the-device", "path": "/ai/examples/764-the-count-was-of-users-and-the-identity-was-the-device.eml.md", "title": "The count was of users and the identity was the device", "description": "`the_count_was_of_users_and_the_identity_was_the_device.eml` - The daily active user figure is deduplicated, bot-filtered, timezone-corrected and reconciled against billing every month, and it has been computed the same way for thirty-four months. What it counts one of is computed below." }, { "id": "765-the-drill-was-run-on-a-tuesday-afternoon", "path": "/ai/examples/765-the-drill-was-run-on-a-tuesday-afternoon.eml.md", "title": "The drill was run on a tuesday afternoon", "description": "`the_drill_was_run_on_a_tuesday_afternoon.eml` - The regional failover is drilled every quarter with real traffic, timed end to end, and the recovery time has been under half an hour every time. When the drills happen is computed below." }, { "id": "766-the-envelope-was-validated-and-the-payload-was-a-string", "path": "/ai/examples/766-the-envelope-was-validated-and-the-payload-was-a-string.eml.md", "title": "The envelope was validated and the payload was a string", "description": "`the_envelope_was_validated_and_the_payload_was_a_string.eml` - Every message on the event bus is validated against a registered schema before the broker will accept it, and the broker rejects what fails. What the schema describes is computed below." }, { "id": "767-the-freshness-was-read-from-the-timestamp-and-the-copy-preserved-it", "path": "/ai/examples/767-the-freshness-was-read-from-the-timestamp-and-the-copy-preserved-it.eml.md", "title": "The freshness was read from the timestamp and the copy preserved it", "description": "`the_freshness_was_read_from_the_timestamp_and_the_copy_preserved_it.eml` - Every feed in the data lake is watched for staleness against a six-hour SLA, the check runs every five minutes, and in twenty months it has caught thirty-one real outages. What the check reads is computed below." }, { "id": "768-the-integration-was-tested-against-the-vendor-sandbox", "path": "/ai/examples/768-the-integration-was-tested-against-the-vendor-sandbox.eml.md", "title": "The integration was tested against the vendor sandbox", "description": "`the_integration_was_tested_against_the_vendor_sandbox.eml` - The payment integration has three hundred and forty tests that run against the vendor's sandbox on every commit, and they cover the vendor's documented error codes rather than our own wrapper. Which counterparty answers them is computed below." }, { "id": "769-the-migration-was-complete-over-the-rows-that-could-be-migrated", "path": "/ai/examples/769-the-migration-was-complete-over-the-rows-that-could-be-migrated.eml.md", "title": "The migration was complete over the rows that could be migrated", "description": "`the_migration_was_complete_over_the_rows_that_could_be_migrated.eml` - The migration reported complete after eleven months, and the work behind that report was done properly. What complete was measured against is computed below." }, { "id": "770-the-on-time-rate-was-over-the-parcels-that-arrived", "path": "/ai/examples/770-the-on-time-rate-was-over-the-parcels-that-arrived.eml.md", "title": "The on time rate was over the parcels that arrived", "description": "`the_on_time_rate_was_over_the_parcels_that_arrived.eml` - On-time delivery has been measured the same way for five years, from a scan taken at the customer's door, against a promise the customers themselves agreed. What a delivery is is computed below." }, { "id": "771-the-renewal-was-automated-and-the-automation-had-its-own-credential", "path": "/ai/examples/771-the-renewal-was-automated-and-the-automation-had-its-own-credential.eml.md", "title": "The renewal was automated and the automation had its own credential", "description": "`the_renewal_was_automated_and_the_automation_had_its_own_credential.eml` - Certificate renewal is fully automated across two thousand one hundred certificates, runs thirty days before expiry, and has gone four years without an expiry incident. What the automation needs in order to run is computed below." }, { "id": "772-the-review-approved-the-diff-and-the-merge-used-a-different-base", "path": "/ai/examples/772-the-review-approved-the-diff-and-the-merge-used-a-different-base.eml.md", "title": "The review approved the diff and the merge used a different base", "description": "`the_review_approved_the_diff_and_the_merge_used_a_different_base.eml` - Nothing reaches the payments service without two approvals, a green build and somebody other than the author pressing merge, and the policy has held for forty months. What the approval was given against is computed below." }, { "id": "773-the-score-came-from-the-surveys-sent-on-resolution", "path": "/ai/examples/773-the-score-came-from-the-surveys-sent-on-resolution.eml.md", "title": "The score came from the surveys sent on resolution", "description": "`the_score_came_from_the_surveys_sent_on_resolution.eml` - The support satisfaction score has sat at 4.72 out of 5 for three years, and the survey behind it is carefully run. When it is sent is computed below." }, { "id": "774-the-spend-stayed-under-budget-and-the-request-was-refused-at-the-door", "path": "/ai/examples/774-the-spend-stayed-under-budget-and-the-request-was-refused-at-the-door.eml.md", "title": "The spend stayed under budget and the request was refused at the door", "description": "`the_spend_stayed_under_budget_and_the_request_was_refused_at_the_door.eml` - The research cluster has not exceeded its monthly budget once in three years, and the control that holds it there is a real one. How it holds is computed below." }, { "id": "775-the-template-was-reviewed-and-the-value-was-interpolated-after", "path": "/ai/examples/775-the-template-was-reviewed-and-the-value-was-interpolated-after.eml.md", "title": "The template was reviewed and the value was interpolated after", "description": "`the_template_was_reviewed_and_the_value_was_interpolated_after.eml` - No notification template reaches production without a security review, the review has run for twenty-six months, and it has caught and fixed seven injections. What the review reads is computed below." }, { "id": "776-the-upgrade-was-rehearsed-from-the-version-nobody-is-on", "path": "/ai/examples/776-the-upgrade-was-rehearsed-from-the-version-nobody-is-on.eml.md", "title": "The upgrade was rehearsed from the version nobody is on", "description": "`the_upgrade_was_rehearsed_from_the_version_nobody_is_on.eml` - The database upgrade was rehearsed twelve times on restored copies of production, timed to the minute, with the rollback rehearsed alongside it. Which upgrade was rehearsed is computed below." }, { "id": "777-the-access-review-asked-the-person-who-granted-it", "path": "/ai/examples/777-the-access-review-asked-the-person-who-granted-it.eml.md", "title": "The access review asked the person who granted it", "description": "`the_access_review_asked_the_person_who_granted_it.eml` - Every entitlement is re-approved by its owner every quarter, eleven quarters running, and an entitlement nobody answers for is revoked automatically. Who the owner is is computed below." }, { "id": "778-the-alert-count-fell-and-the-thresholds-were-raised", "path": "/ai/examples/778-the-alert-count-fell-and-the-thresholds-were-raised.eml.md", "title": "The alert count fell and the thresholds were raised", "description": "`the_alert_count_fell_and_the_thresholds_were_raised.eml` - The noise programme cut alerts from four thousand one hundred a week to six hundred and twenty, and every change was reviewed. Which changes they were is computed below." }, { "id": "779-the-audit-sampled-by-row-and-the-money-was-in-a-few", "path": "/ai/examples/779-the-audit-sampled-by-row-and-the-money-was-in-a-few.eml.md", "title": "The audit sampled by row and the money was in a few", "description": "`the_audit_sampled_by_row_and_the_money_was_in_a_few.eml` - The expense audit draws a genuine random sample every quarter, and the sampling is the part it gets right. What the sample is a sample of is computed below." }, { "id": "780-the-availability-was-four-nines-and-one-tenant-had-none", "path": "/ai/examples/780-the-availability-was-four-nines-and-one-tenant-had-none.eml.md", "title": "The availability was four nines and one tenant had none", "description": "`the_availability_was_four_nines_and_one_tenant_had_none.eml` - Availability has been above its target for twenty-two months, measured from real requests rather than from a synthetic probe. What the number is an average over is computed below." }, { "id": "781-the-capacity-was-sufficient-and-one-hour-a-week-was-not", "path": "/ai/examples/781-the-capacity-was-sufficient-and-one-hour-a-week-was-not.eml.md", "title": "The capacity was sufficient and one hour a week was not", "description": "`the_capacity_was_sufficient_and_one_hour_a_week_was_not.eml` - Capacity planning has shown comfortable headroom for fourteen months, and the planning is careful. What the headroom is an average over is computed below." }, { "id": "782-the-checklist-was-published-and-the-failures-moved-off-it", "path": "/ai/examples/782-the-checklist-was-published-and-the-failures-moved-off-it.eml.md", "title": "The checklist was published and the failures moved off it", "description": "`the_checklist_was_published_and_the_failures_moved_off_it.eml` - The internal audit checklist was published so teams could prepare, and findings per audit fell by three quarters in the two years since. What moved is computed below." }, { "id": "783-the-coverage-target-was-met-and-the-assertions-thinned", "path": "/ai/examples/783-the-coverage-target-was-met-and-the-assertions-thinned.eml.md", "title": "The coverage target was met and the assertions thinned", "description": "`the_coverage_target_was_met_and_the_assertions_thinned.eml` - Line coverage on the semantics packages has been above its eighty-five percent target for nine quarters, and the gate that enforces it is real. What rose with it is computed below." }, { "id": "784-the-error-budget-was-spent-evenly-and-one-endpoint-ate-it", "path": "/ai/examples/784-the-error-budget-was-spent-evenly-and-one-endpoint-ate-it.eml.md", "title": "The error budget was spent evenly and one endpoint ate it", "description": "`the_error_budget_was_spent_evenly_and_one_endpoint_ate_it.eml` - The service has stayed inside its quarterly error budget for eleven quarters, and the budget is a real constraint rather than a slogan. What it is a budget over is computed below." }, { "id": "785-the-first-response-time-was-met-by-an-acknowledgement", "path": "/ai/examples/785-the-first-response-time-was-met-by-an-acknowledgement.eml.md", "title": "The first response time was met by an acknowledgement", "description": "`the_first_response_time_was_met_by_an_acknowledgement.eml` - Every ticket gets a first response within fifteen minutes, and the target has been met every month for fourteen months. What counts as a response is computed below." }, { "id": "786-the-intake-form-got-longer-and-the-queue-got-shorter", "path": "/ai/examples/786-the-intake-form-got-longer-and-the-queue-got-shorter.eml.md", "title": "The intake form got longer and the queue got shorter", "description": "`the_intake_form_got_longer_and_the_queue_got_shorter.eml` - The platform team rewrote its request form to capture what it actually needed, and the queue wait fell from twenty-one days to five. What else changed is computed below." }, { "id": "787-the-model-reported-its-own-confidence", "path": "/ai/examples/787-the-model-reported-its-own-confidence.eml.md", "title": "The model reported its own confidence", "description": "`the_model_reported_its_own_confidence.eml` - The classifier decides a document only when it is confident, and everything below the threshold goes to a person. Where the confidence comes from is computed below." }, { "id": "788-the-provenance-was-signed-by-the-builder", "path": "/ai/examples/788-the-provenance-was-signed-by-the-builder.eml.md", "title": "The provenance was signed by the builder", "description": "`the_provenance_was_signed_by_the_builder.eml` - Nothing deploys without a signed provenance statement naming its source commit, its builder image and every step that ran, and the admission controller refuses anything that does not verify. Who writes the statement is computed below." }, { "id": "789-the-questionnaire-was-answered-by-the-vendor", "path": "/ai/examples/789-the-questionnaire-was-answered-by-the-vendor.eml.md", "title": "The questionnaire was answered by the vendor", "description": "`the_questionnaire_was_answered_by_the_vendor.eml` - Every vendor that touches customer data completes a one-hundred-and-eighty-question security review before a contract is signed, and forty-one have been rejected or made to remediate. Who writes the answers is computed below." }, { "id": "790-the-refund-rate-was-normal-and-one-cohort-was-all-of-it", "path": "/ai/examples/790-the-refund-rate-was-normal-and-one-cohort-was-all-of-it.eml.md", "title": "The refund rate was normal and one cohort was all of it", "description": "`the_refund_rate_was_normal_and_one_cohort_was_all_of_it.eml` - The refund rate has been at or below its historical level for nineteen months, and it is measured carefully. What it is an average over is computed below." }, { "id": "791-the-severity-was-set-by-the-team-that-owed-the-postmortem", "path": "/ai/examples/791-the-severity-was-set-by-the-team-that-owed-the-postmortem.eml.md", "title": "The severity was set by the team that owed the postmortem", "description": "`the_severity_was_set_by_the_team_that_owed_the_postmortem.eml` - Incident severity is written down, exemplified, and cannot be lowered after the fact without a second approver, and it has worked that way for four years. Who assigns it is computed below." }, { "id": "792-the-average-speed-was-the-mean-of-the-legs", "path": "/ai/examples/792-the-average-speed-was-the-mean-of-the-legs.eml.md", "title": "The average speed was the mean of the legs", "description": "`the_average_speed_was_the_mean_of_the_legs.eml` - The trip was 30 km/h out and 60 km/h back over the same road, and both speeds are measured correctly. What the average over the whole trip is is computed below." }, { "id": "793-the-backup-counted-the-files-it-chose", "path": "/ai/examples/793-the-backup-counted-the-files-it-chose.eml.md", "title": "The backup counted the files it chose", "description": "`the_backup_counted_the_files_it_chose.eml` - The nightly backup has reported success with zero errors for the whole quarter, and every count it reports is true. What it never enumerated is computed below." }, { "id": "794-the-cursor-was-saved-after-the-effect", "path": "/ai/examples/794-the-cursor-was-saved-after-the-effect.eml.md", "title": "The cursor was saved after the effect", "description": "`the_cursor_was_saved_after_the_effect.eml` - The poller has processed every record in order without skipping one, and the ordering is correct. What the saved cursor and the effect straddle is computed below." }, { "id": "795-the-dedup-hash-included-the-timestamp", "path": "/ai/examples/795-the-dedup-hash-included-the-timestamp.eml.md", "title": "The dedup hash included the timestamp", "description": "`the_dedup_hash_included_the_timestamp.eml` - The event store deduplicates by content hash, and the hashing is correct. What the hash is taken over is computed below." }, { "id": "796-the-delivery-was-confirmed-by-the-senders-receipt", "path": "/ai/examples/796-the-delivery-was-confirmed-by-the-senders-receipt.eml.md", "title": "The delivery was confirmed by the senders receipt", "description": "`the_delivery_was_confirmed_by_the_senders_receipt.eml` - The delivery rate has been at 100 per hundred for the whole quarter, and every delivery it counts is real. What a delivery is counted at is computed below." }, { "id": "797-the-delivery-was-exactly-once-and-the-effect-was-not", "path": "/ai/examples/797-the-delivery-was-exactly-once-and-the-effect-was-not.eml.md", "title": "The delivery was exactly once and the effect was not", "description": "`the_delivery_was_exactly_once_and_the_effect_was_not.eml` - The queue delivers each message to the handler exactly once, and that property holds. Where the handler's effect lands relative to it is computed below." }, { "id": "798-the-growth-was-the-mean-of-the-monthly-rates", "path": "/ai/examples/798-the-growth-was-the-mean-of-the-monthly-rates.eml.md", "title": "The growth was the mean of the monthly rates", "description": "`the_growth_was_the_mean_of_the_monthly_rates.eml` - The average monthly growth rate is reported correctly, and each monthly figure is a true rate. What the annual number is a combination of is computed below." }, { "id": "799-the-idempotency-key-was-regenerated-on-each-retry", "path": "/ai/examples/799-the-idempotency-key-was-regenerated-on-each-retry.eml.md", "title": "The idempotency key was regenerated on each retry", "description": "`the_idempotency_key_was_regenerated_on_each_retry.eml` - Every charge went through an idempotent endpoint, and the server's dedup is correct. What the key is per is computed below." }, { "id": "800-the-lease-expired-and-the-write-had-no-fence", "path": "/ai/examples/800-the-lease-expired-and-the-write-had-no-fence.eml.md", "title": "The lease expired and the write had no fence", "description": "`the_lease_expired_and_the_write_had_no_fence.eml` - The distributed lock hands out a lease, and the lease logic is correct. What the store checks when a write arrives is computed below." }, { "id": "801-the-liveness-probe-was-answered-from-cache", "path": "/ai/examples/801-the-liveness-probe-was-answered-from-cache.eml.md", "title": "The liveness probe was answered from cache", "description": "`the_liveness_probe_was_answered_from_cache.eml` - The liveness probe has returned 200 on every check for the whole day, and each 200 is true. What the probe actually exercised is computed below." }, { "id": "802-the-payload-was-valid-against-the-schema-it-carried", "path": "/ai/examples/802-the-payload-was-valid-against-the-schema-it-carried.eml.md", "title": "The payload was valid against the schema it carried", "description": "`the_payload_was_valid_against_the_schema_it_carried.eml` - Every message this month validated, and each validation is a true statement. What it was true against is computed below." }, { "id": "803-the-percentile-was-averaged-across-the-shards", "path": "/ai/examples/803-the-percentile-was-averaged-across-the-shards.eml.md", "title": "The percentile was averaged across the shards", "description": "`the_percentile_was_averaged_across_the_shards.eml` - The dashboard p99 latency has been under the 300 ms SLO all quarter, and each per-shard number it combines is true. How the one figure is combined is computed below." }, { "id": "804-the-total-was-the-sum-of-the-rounded-rows", "path": "/ai/examples/804-the-total-was-the-sum-of-the-rounded-rows.eml.md", "title": "The total was the sum of the rounded rows", "description": "`the_total_was_the_sum_of_the_rounded_rows.eml` - Every line on the invoice run is correct to the cent, and so is each rounding. What the total is a sum of is computed below." }, { "id": "805-the-two-discounts-were-added", "path": "/ai/examples/805-the-two-discounts-were-added.eml.md", "title": "The two discounts were added", "description": "`the_two_discounts_were_added.eml` - The promotion is \"20% off, then 30% off\", and each discount is applied correctly. What the two together come to is computed below." }, { "id": "806-the-uptime-was-measured-from-inside-the-service", "path": "/ai/examples/806-the-uptime-was-measured-from-inside-the-service.eml.md", "title": "The uptime was measured from inside the service", "description": "`the_uptime_was_measured_from_inside_the_service.eml` - The uptime monitor recorded no failed checks all month, and every check it recorded is true. What it could not record is computed below." }, { "id": "807-the-amounts-were-summed-at-each-days-rate", "path": "/ai/examples/807-the-amounts-were-summed-at-each-days-rate.eml.md", "title": "The amounts were summed at each days rate", "description": "`the_amounts_were_summed_at_each_days_rate.eml` - The multi-currency balance is summed correctly to a single dollar figure, and each conversion is right. What rate each line was converted at is computed below." }, { "id": "808-the-balance-was-non-negative-at-every-commit", "path": "/ai/examples/808-the-balance-was-non-negative-at-every-commit.eml.md", "title": "The balance was non negative at every commit", "description": "`the_balance_was_non_negative_at_every_commit.eml` - Every committed transaction left the account non-negative, and each check is real. What two concurrent withdrawals each validated against is computed below." }, { "id": "809-the-day-boundary-was-the-servers-and-the-user-was-elsewhere", "path": "/ai/examples/809-the-day-boundary-was-the-servers-and-the-user-was-elsewhere.eml.md", "title": "The day boundary was the servers and the user was elsewhere", "description": "`the_day_boundary_was_the_servers_and_the_user_was_elsewhere.eml` - The daily active count is computed correctly every day, and no event is counted twice. What defines the day it lands in is computed below." }, { "id": "810-the-eta-was-linear-and-the-work-was-not", "path": "/ai/examples/810-the-eta-was-linear-and-the-work-was-not.eml.md", "title": "The eta was linear and the work was not", "description": "`the_eta_was_linear_and_the_work_was_not.eml` - The job is 90 per hundred done and the ETA says ten minutes, and the arithmetic is right. What the ETA assumes is computed below." }, { "id": "811-the-freshness-was-measured-from-publish-not-event", "path": "/ai/examples/811-the-freshness-was-measured-from-publish-not-event.eml.md", "title": "The freshness was measured from publish not event", "description": "`the_freshness_was_measured_from_publish_not_event.eml` - The dashboard data has been under its three-second freshness SLA all quarter, and the number is real. What instant freshness is measured from is computed below." }, { "id": "812-the-migration-steps-were-each-reversible-and-the-sequence-was-not", "path": "/ai/examples/812-the-migration-steps-were-each-reversible-and-the-sequence-was-not.eml.md", "title": "The migration steps were each reversible and the sequence was not", "description": "`the_migration_steps_were_each_reversible_and_the_sequence_was_not.eml` - Every step of the migration ships with a down-migration, and each reverse is correct on its own. What happens when the sequence is rolled back is computed below." }, { "id": "813-the-model-was-validated-on-the-data-it-was-trained-on", "path": "/ai/examples/813-the-model-was-validated-on-the-data-it-was-trained-on.eml.md", "title": "The model was validated on the data it was trained on", "description": "`the_model_was_validated_on_the_data_it_was_trained_on.eml` - The classifier scored 98 per hundred at validation, and the score is real. What set it was scored on is computed below." }, { "id": "814-the-modules-each-compiled-and-the-imports-formed-a-cycle", "path": "/ai/examples/814-the-modules-each-compiled-and-the-imports-formed-a-cycle.eml.md", "title": "The modules each compiled and the imports formed a cycle", "description": "`the_modules_each_compiled_and_the_imports_formed_a_cycle.eml` - Every module in the build compiles on its own, and each compile is real. What the import graph does is computed below." }, { "id": "815-the-page-was-assembled-from-fragments-each-fresh", "path": "/ai/examples/815-the-page-was-assembled-from-fragments-each-fresh.eml.md", "title": "The page was assembled from fragments each fresh", "description": "`the_page_was_assembled_from_fragments_each_fresh.eml` - Every fragment on the page was within its cache TTL when it was read, and each freshness check is real. When the fragments were read relative to each other is computed below." }, { "id": "816-the-reconciliation-matched-the-ledger-to-its-own-export", "path": "/ai/examples/816-the-reconciliation-matched-the-ledger-to-its-own-export.eml.md", "title": "The reconciliation matched the ledger to its own export", "description": "`the_reconciliation_matched_the_ledger_to_its_own_export.eml` - The daily reconciliation has matched to the cent for the whole quarter, and the match is real. What the two sides of it are is computed below." }, { "id": "817-the-shares-were-rounded-and-summed-to-101", "path": "/ai/examples/817-the-shares-were-rounded-and-summed-to-101.eml.md", "title": "The shares were rounded and summed to 101", "description": "`the_shares_were_rounded_and_summed_to_101.eml` - Three shares of a whole are each rounded to a correct whole percent, and each rounding is right. What they sum to is computed below." }, { "id": "818-the-target-was-per-calendar-month-and-the-months-were-unequal", "path": "/ai/examples/818-the-target-was-per-calendar-month-and-the-months-were-unequal.eml.md", "title": "The target was per calendar month and the months were unequal", "description": "`the_target_was_per_calendar_month_and_the_months_were_unequal.eml` - The team hit its monthly target in July and missed it in February, and both counts are right. What the target is denominated in is computed below." }, { "id": "819-the-three-checks-agreed-and-read-one-feed", "path": "/ai/examples/819-the-three-checks-agreed-and-read-one-feed.eml.md", "title": "The three checks agreed and read one feed", "description": "`the_three_checks_agreed_and_read_one_feed.eml` - Three independent checks confirm the reference price before a trade, and they have agreed on every trade this quarter. What they read is computed below." }, { "id": "820-the-translation-was-checked-by-translating-it-back", "path": "/ai/examples/820-the-translation-was-checked-by-translating-it-back.eml.md", "title": "The translation was checked by translating it back", "description": "`the_translation_was_checked_by_translating_it_back.eml` - The translation passed its round-trip check on 97 of every 100 sentences, and the check is real. What does the translating back is computed below." }, { "id": "821-the-two-sensors-agreed-and-shared-a-calibration", "path": "/ai/examples/821-the-two-sensors-agreed-and-shared-a-calibration.eml.md", "title": "The two sensors agreed and shared a calibration", "description": "`the_two_sensors_agreed_and_shared_a_calibration.eml` - The two pressure sensors have agreed within one unit all year, and the agreement is real. What they were zeroed against is computed below." }, { "id": "822-the-cache-served-through-the-origin-outage", "path": "/ai/examples/822-the-cache-served-through-the-origin-outage.eml.md", "title": "The cache served through the origin outage", "description": "`the_cache_served_through_the_origin_outage.eml` - The service stayed healthy through the forty minutes under review, and every health signal it read was real. What health is measured on is computed below." }, { "id": "823-the-constraint-was-added-going-forward", "path": "/ai/examples/823-the-constraint-was-added-going-forward.eml.md", "title": "The constraint was added going forward", "description": "`the_constraint_was_added_going_forward.eml` - The column has a NOT NULL constraint and every write since it was added has honored it. What the constraint applies to is computed below." }, { "id": "824-the-empty-result-was-cached-as-the-answer", "path": "/ai/examples/824-the-empty-result-was-cached-as-the-answer.eml.md", "title": "The empty result was cached as the answer", "description": "`the_empty_result_was_cached_as_the_answer.eml` - The lookup service served every request from cache with a 300-second freshness window, and every value it served was within that window. What a failed fetch stored is computed below." }, { "id": "825-the-gauge-was-polled-by-the-minute-and-billed-by-the-second", "path": "/ai/examples/825-the-gauge-was-polled-by-the-minute-and-billed-by-the-second.eml.md", "title": "The gauge was polled by the minute and billed by the second", "description": "`the_gauge_was_polled_by_the_minute_and_billed_by_the_second.eml` - The bandwidth monitor showed a comfortable peak under the alert threshold all month, and every sample it took was real. What resolution the monitor reads at, against what resolution the bill is computed at, is computed below." }, { "id": "826-the-heartbeat-stopped-and-the-status-stayed-green", "path": "/ai/examples/826-the-heartbeat-stopped-and-the-status-stayed-green.eml.md", "title": "The heartbeat stopped and the status stayed green", "description": "`the_heartbeat_stopped_and_the_status_stayed_green.eml` - The service status board has shown green for the whole shift, and every status it displayed was the one the service reported. What a stopped report displays as is computed below." }, { "id": "827-the-missing-metric-was-read-as-zero", "path": "/ai/examples/827-the-missing-metric-was-read-as-zero.eml.md", "title": "The missing metric was read as zero", "description": "`the_missing_metric_was_read_as_zero.eml` - The load alert has not fired in the sixty minutes under review, and every sample it read was under the threshold. What a sample that was not read counts as is computed below." }, { "id": "828-the-queue-was-empty-because-the-producer-died", "path": "/ai/examples/828-the-queue-was-empty-because-the-producer-died.eml.md", "title": "The queue was empty because the producer died", "description": "`the_queue_was_empty_because_the_producer_died.eml` - The consumer autoscaler scaled down to its floor when the queue drained, and its rule read the depth correctly. What a depth of zero means is computed below." }, { "id": "829-the-rate-rounded-to-zero", "path": "/ai/examples/829-the-rate-rounded-to-zero.eml.md", "title": "The rate rounded to zero", "description": "`the_rate_rounded_to_zero.eml` - The error rate reads zero per ten thousand and the arithmetic that produced it is exact. What resolution that unit has, against how rare the errors are, is computed below." }, { "id": "830-the-second-incident-was-deduplicated-into-the-first", "path": "/ai/examples/830-the-second-incident-was-deduplicated-into-the-first.eml.md", "title": "The second incident was deduplicated into the first", "description": "`the_second_incident_was_deduplicated_into_the_first.eml` - Every distinct alert fingerprint paged on-call this shift, and the dedup that suppressed the rest removed only exact repeats. What a fingerprint groups together is computed below." }, { "id": "831-the-signature-was-over-a-set-and-the-order-mattered", "path": "/ai/examples/831-the-signature-was-over-a-set-and-the-order-mattered.eml.md", "title": "The signature was over a set and the order mattered", "description": "`the_signature_was_over_a_set_and_the_order_mattered.eml` - The change detector reported the routing ruleset unchanged across a deploy, and its signature was computed correctly. What the signature is over is computed below." }, { "id": "832-the-spike-fit-between-two-samples", "path": "/ai/examples/832-the-spike-fit-between-two-samples.eml.md", "title": "The spike fit between two samples", "description": "`the_spike_fit_between_two_samples.eml` - The utilisation gauge stayed under its ceiling for the whole hour, and every sample it took was real. How often it samples, against how long the spike lasted, is computed below." }, { "id": "833-the-two-events-shared-a-timestamp-and-the-tie-decided", "path": "/ai/examples/833-the-two-events-shared-a-timestamp-and-the-tie-decided.eml.md", "title": "The two events shared a timestamp and the tie decided", "description": "`the_two_events_shared_a_timestamp_and_the_tie_decided.eml` - Conflicts are resolved last-write-wins by timestamp, and the timestamps are real and correct. What resolution the timestamp has, against how close the events were, is computed below." }, { "id": "834-the-validation-ran-after-the-write", "path": "/ai/examples/834-the-validation-ran-after-the-write.eml.md", "title": "The validation ran after the write", "description": "`the_validation_ran_after_the_write.eml` - The validation job flagged every invalid record it was given, and its rules are correct. When it runs relative to the write is computed below." }, { "id": "835-the-value-round-tripped-through-json-and-lost-precision", "path": "/ai/examples/835-the-value-round-tripped-through-json-and-lost-precision.eml.md", "title": "The value round tripped through json and lost precision", "description": "`the_value_round_tripped_through_json_and_lost_precision.eml` - The account ids survived every hop of the pipeline unchanged, and each hop's check passed. What format carries them between hops is computed below." }, { "id": "836-the-values-were-equal-as-floats", "path": "/ai/examples/836-the-values-were-equal-as-floats.eml.md", "title": "The values were equal as floats", "description": "`the_values_were_equal_as_floats.eml` - The reconciliation passed on every pair it compared, and each comparison ran without error. What the comparison treats as equal is computed below." }, { "id": "837-all-the-candidates-passed-after-the-filter-emptied-the-set", "path": "/ai/examples/837-all-the-candidates-passed-after-the-filter-emptied-the-set.eml.md", "title": "All the candidates passed after the filter emptied the set", "description": "`all_the_candidates_passed_after_the_filter_emptied_the_set.eml` - Every candidate release passed the safety gate this quarter, and each gate check is real. How many candidates reached the gate is computed below." }, { "id": "838-every-eligible-record-was-processed-and-none-were-eligible", "path": "/ai/examples/838-every-eligible-record-was-processed-and-none-were-eligible.eml.md", "title": "Every eligible record was processed and none were eligible", "description": "`every_eligible_record_was_processed_and_none_were_eligible.eml` - The nightly job reports 100 per hundred of eligible records processed, and the count is honest. How many records were eligible is computed below." }, { "id": "839-the-amount-was-parsed-in-the-wrong-locale", "path": "/ai/examples/839-the-amount-was-parsed-in-the-wrong-locale.eml.md", "title": "The amount was parsed in the wrong locale", "description": "`the_amount_was_parsed_in_the_wrong_locale.eml` - The importer parses every amount in the vendor file and rejects anything unparseable, and the parser is correct. What locale it parses in is computed below." }, { "id": "840-the-count-excluded-the-nulls", "path": "/ai/examples/840-the-count-excluded-the-nulls.eml.md", "title": "The count excluded the nulls", "description": "`the_count_excluded_the_nulls.eml` - The average rating is 8.00 and the query that produced it is correct SQL. What the denominator counts is computed below." }, { "id": "841-the-filter-was-not-equal-and-the-nulls-vanished", "path": "/ai/examples/841-the-filter-was-not-equal-and-the-nulls-vanished.eml.md", "title": "The filter was not equal and the nulls vanished", "description": "`the_filter_was_not_equal_and_the_nulls_vanished.eml` - The query for rows that are not closed returns exactly the rows whose status differs from 'closed', and the SQL is correct. What a NULL status does to that test is computed below." }, { "id": "842-the-flag-was-the-string-false", "path": "/ai/examples/842-the-flag-was-the-string-false.eml.md", "title": "The flag was the string false", "description": "`the_flag_was_the_string_false.eml` - The feature is gated behind a config flag and the gate reads the flag on every request. What the flag's value is is computed below." }, { "id": "843-the-ids-were-sorted-as-text", "path": "/ai/examples/843-the-ids-were-sorted-as-text.eml.md", "title": "The ids were sorted as text", "description": "`the_ids_were_sorted_as_text.eml` - The export lists records in ascending id order and the sort is correct. What kind of order it is is computed below." }, { "id": "844-the-invariant-held-over-an-empty-collection", "path": "/ai/examples/844-the-invariant-held-over-an-empty-collection.eml.md", "title": "The invariant held over an empty collection", "description": "`the_invariant_held_over_an_empty_collection.eml` - The property test asserts that every open position nets to within the risk limit, and it has passed on every run for the quarter. How many positions it quantifies over is computed below." }, { "id": "845-the-migration-touched-no-rows-and-passed-every-check", "path": "/ai/examples/845-the-migration-touched-no-rows-and-passed-every-check.eml.md", "title": "The migration touched no rows and passed every check", "description": "`the_migration_touched_no_rows_and_passed_every_check.eml` - The data migration passed every post-migration check, and each check is real. How many rows the migration touched is computed below." }, { "id": "846-the-not-in-list-had-a-null", "path": "/ai/examples/846-the-not-in-list-had-a-null.eml.md", "title": "The not in list had a null", "description": "`the_not_in_list_had_a_null.eml` - The query returns the accounts that are not on the block list, and the SQL is correct. What one NULL in that list does is computed below." }, { "id": "847-the-outer-join-became-inner", "path": "/ai/examples/847-the-outer-join-became-inner.eml.md", "title": "The outer join became inner", "description": "`the_outer_join_became_inner.eml` - The orders report joins every order to its shipment and the LEFT JOIN is written correctly. What a WHERE on the shipment column does to it is computed below." }, { "id": "848-the-slo-was-met-over-a-window-with-no-requests", "path": "/ai/examples/848-the-slo-was-met-over-a-window-with-no-requests.eml.md", "title": "The slo was met over a window with no requests", "description": "`the_slo_was_met_over_a_window_with_no_requests.eml` - The latency SLO reads 100 per hundred met for the hour under review, and the computation is honest. How many requests that hour is computed below." }, { "id": "849-the-timestamps-were-ordered-as-text", "path": "/ai/examples/849-the-timestamps-were-ordered-as-text.eml.md", "title": "The timestamps were ordered as text", "description": "`the_timestamps_were_ordered_as_text.eml` - The audit log is ordered by timestamp and the sort is correct. What kind of order it is is computed below." }, { "id": "850-the-top-rows-were-the-nulls", "path": "/ai/examples/850-the-top-rows-were-the-nulls.eml.md", "title": "The top rows were the nulls", "description": "`the_top_rows_were_the_nulls.eml` - The leaderboard shows the top ten by score, ordered descending, and the ORDER BY is correct. Where a NULL score sorts is computed below." }, { "id": "851-the-versions-were-compared-as-strings", "path": "/ai/examples/851-the-versions-were-compared-as-strings.eml.md", "title": "The versions were compared as strings", "description": "`the_versions_were_compared_as_strings.eml` - The deploy picks the latest version by taking the maximum of the version column, and the maximum is computed correctly. What kind of maximum it is is computed below." }, { "id": "852-the-ages-were-bucketed-and-the-mean-used-the-midpoints", "path": "/ai/examples/852-the-ages-were-bucketed-and-the-mean-used-the-midpoints.eml.md", "title": "The ages were bucketed and the mean used the midpoints", "description": "`the_ages_were_bucketed_and_the_mean_used_the_midpoints.eml` - A survey reports the average age, computed as the weighted mean of the age-bucket midpoints, and the arithmetic is correct over every respondent. What a bucket midpoint stands in for is computed below." }, { "id": "853-the-anchor-bound-to-one-alternative", "path": "/ai/examples/853-the-anchor-bound-to-one-alternative.eml.md", "title": "The anchor bound to one alternative", "description": "`the_anchor_bound_to_one_alternative.eml` - A whitelist accepts a value only if it is exactly \"cat\" or \"dog\", and it uses the regex engine correctly on every value. What the anchors bind to is computed below." }, { "id": "854-the-character-class-was-a-range-not-a-number", "path": "/ai/examples/854-the-character-class-was-a-range-not-a-number.eml.md", "title": "The character class was a range not a number", "description": "`the_character_class_was_a_range_not_a_number.eml` - A validator checks that a day-of-month value is in 1 to 31, and it uses the regex engine correctly on every value. What the character class actually denotes is computed below." }, { "id": "855-the-dollar-sign-matched-the-end-of-a-line", "path": "/ai/examples/855-the-dollar-sign-matched-the-end-of-a-line.eml.md", "title": "The dollar sign matched the end of a line", "description": "`the_dollar_sign_matched_the_end_of_a_line.eml` - A validator checks that a field is digits and nothing else, and it uses the regex engine correctly on every submission. What the end-anchor matches is computed below." }, { "id": "856-the-first-seen-was-read-as-the-first-time", "path": "/ai/examples/856-the-first-seen-was-read-as-the-first-time.eml.md", "title": "The first seen was read as the first time", "description": "`the_first_seen_was_read_as_the_first_time.eml` - A cohort report counts accounts acquired in the first month, and it reads the earliest recorded activity for every account correctly. What the earliest record actually marks is computed below." }, { "id": "857-the-launch-rode-a-trend-that-was-already-there", "path": "/ai/examples/857-the-launch-rode-a-trend-that-was-already-there.eml.md", "title": "The launch rode a trend that was already there", "description": "`the_launch_rode_a_trend_that_was_already_there.eml` - A feature launched in November and conversions rose 20 percent. The counts are real and the before-and-after is honest. Whether the feature caused the rise is computed below." }, { "id": "858-the-long-runs-were-oversampled-by-the-sampler", "path": "/ai/examples/858-the-long-runs-were-oversampled-by-the-sampler.eml.md", "title": "The long runs were oversampled by the sampler", "description": "`the_long_runs_were_oversampled_by_the_sampler.eml` - A profiler estimates the average request latency by sampling the currently-running request at random instants, and it averages the samples correctly. How a request comes to be sampled is computed below." }, { "id": "859-the-open-cases-were-left-out-of-the-average", "path": "/ai/examples/859-the-open-cases-were-left-out-of-the-average.eml.md", "title": "The open cases were left out of the average", "description": "`the_open_cases_were_left_out_of_the_average.eml` - A report gives the average time to resolve a ticket, and it averages the real resolution times of every resolved ticket correctly. Which tickets can be in the average is computed below." }, { "id": "860-the-pattern-matched-a-prefix-and-passed-the-whole", "path": "/ai/examples/860-the-pattern-matched-a-prefix-and-passed-the-whole.eml.md", "title": "The pattern matched a prefix and passed the whole", "description": "`the_pattern_matched_a_prefix_and_passed_the_whole.eml` - A validator checks that a submitted code is a six-digit number, and it uses the regex engine correctly on every submission. What the pattern is anchored to is computed below." }, { "id": "861-the-quantifier-was-greedy-and-ate-the-delimiter", "path": "/ai/examples/861-the-quantifier-was-greedy-and-ate-the-delimiter.eml.md", "title": "The quantifier was greedy and ate the delimiter", "description": "`the_quantifier_was_greedy_and_ate_the_delimiter.eml` - A parser extracts the first quoted field from each record, and it uses the regex engine correctly on every record. What the quantifier does at the delimiter is computed below." }, { "id": "862-the-readings-below-the-limit-were-recorded-as-zero", "path": "/ai/examples/862-the-readings-below-the-limit-were-recorded-as-zero.eml.md", "title": "The readings below the limit were recorded as zero", "description": "`the_readings_below_the_limit_were_recorded_as_zero.eml` - A water-quality report gives the average contaminant level, and it averages the real recorded readings of every sample correctly. What a recorded zero means is computed below." }, { "id": "863-the-selected-set-made-two-causes-look-opposed", "path": "/ai/examples/863-the-selected-set-made-two-causes-look-opposed.eml.md", "title": "The selected set made two causes look opposed", "description": "`the_selected_set_made_two_causes_look_opposed.eml` - Among admitted students, academic and athletic scores are negatively related: the weaker a student is academically, the stronger athletically. The correlation is real and correctly computed. What the sample was conditioned on is computed below." }, { "id": "864-the-treatment-group-had-already-survived", "path": "/ai/examples/864-the-treatment-group-had-already-survived.eml.md", "title": "The treatment group had already survived", "description": "`the_treatment_group_had_already_survived.eml` - Patients in a follow-up program lived longer than patients not in it, and the survival times are real and correctly averaged. What defines who is 'in the program' is computed below." }, { "id": "865-the-volunteers-differed-before-they-volunteered", "path": "/ai/examples/865-the-volunteers-differed-before-they-volunteered.eml.md", "title": "The volunteers differed before they volunteered", "description": "`the_volunteers_differed_before_they_volunteered.eml` - Employees who joined the wellness program are 20 points healthier than those who did not. The scores are real and the comparison is honest. What made someone a participant is computed below." }, { "id": "866-the-worst-performers-improved-on-their-own", "path": "/ai/examples/866-the-worst-performers-improved-on-their-own.eml.md", "title": "The worst performers improved on their own", "description": "`the_worst_performers_improved_on_their_own.eml` - A coaching program was given to the 100 worst-performing stores, and the next quarter they improved. The improvement is real and correctly measured. Whether the coaching caused it is computed below." }, { "id": "867-the-abstainers-were-counted-as-no", "path": "/ai/examples/867-the-abstainers-were-counted-as-no.eml.md", "title": "The abstainers were counted as no", "description": "`the_abstainers_were_counted_as_no.eml` - A referendum passes only if a majority of all eligible voters approve it, every ballot was counted exactly, and seventy percent of those who voted said yes. What the rule does with the people who did not vote is computed below." }, { "id": "868-the-area-was-measured-on-the-map", "path": "/ai/examples/868-the-area-was-measured-on-the-map.eml.md", "title": "The area was measured on the map", "description": "`the_area_was_measured_on_the_map.eml` - A coverage report gives each region's share of the mapped land, computed from the pixels each region occupies on the web map. The pixel counts are real and the shares are correctly divided. What a pixel of the map measures is computed below." }, { "id": "869-the-bounding-box-crossed-the-date-line", "path": "/ai/examples/869-the-bounding-box-crossed-the-date-line.eml.md", "title": "The bounding box crossed the date line", "description": "`the_bounding_box_crossed_the_date_line.eml` - A region query returns every point inside the region's bounding box, and it builds that box from the region's real minimum and maximum longitudes. What min and max mean across the 180th meridian is computed below." }, { "id": "870-the-compromise-was-everyones-last-choice", "path": "/ai/examples/870-the-compromise-was-everyones-last-choice.eml.md", "title": "The compromise was everyones last choice", "description": "`the_compromise_was_everyones_last_choice.eml` - A committee picks the venue for a hundred people by taking the option in the middle of the preferences - the one that offers a little of everything - and every ranking used is real and every voter is counted. Where each voter ranks that middle option is computed below." }, { "id": "871-the-degrees-were-measured-on-a-flat-plane", "path": "/ai/examples/871-the-degrees-were-measured-on-a-flat-plane.eml.md", "title": "The degrees were measured on a flat plane", "description": "`the_degrees_were_measured_on_a_flat_plane.eml` - A dispatch service picks the nearest warehouse to a customer, and it applies its distance formula to the real coordinates of every warehouse. What a degree of longitude is worth is computed below." }, { "id": "872-the-extra-seat-took-one-away", "path": "/ai/examples/872-the-extra-seat-took-one-away.eml.md", "title": "The extra seat took one away", "description": "`the_extra_seat_took_one_away.eml` - Seats are shared among three regions by the largest-remainder rule: each region gets the whole part of its exact share, and the seats left over go to the largest fractional remainders. The rule is applied exactly to the real populations. What happens to the smallest region when the house grows by one seat is computed below." }, { "id": "873-the-id-space-was-smaller-than-the-records", "path": "/ai/examples/873-the-id-space-was-smaller-than-the-records.eml.md", "title": "The id space was smaller than the records", "description": "`the_id_space_was_smaller_than_the_records.eml` - Every record is given a random four-character hex identifier, and every identifier is drawn uniformly by the engine's generator and checked for format. How many distinct identifiers four hex characters can hold is computed below." }, { "id": "874-the-nearest-was-across-the-river", "path": "/ai/examples/874-the-nearest-was-across-the-river.eml.md", "title": "The nearest was across the river", "description": "`the_nearest_was_across_the_river.eml` - A delivery service fulfils each order from the nearest store, and it measures the distance from the real coordinates of every store correctly. What kind of distance it measures is computed below." }, { "id": "875-the-pairs-were-counted-as-the-parts", "path": "/ai/examples/875-the-pairs-were-counted-as-the-parts.eml.md", "title": "The pairs were counted as the parts", "description": "`the_pairs_were_counted_as_the_parts.eml` - An integration plan declares all ten services tested for compatibility, and every one of the ten tests it lists really ran and passed. What compatibility is a property of is computed below." }, { "id": "876-the-radius-was-a-square", "path": "/ai/examples/876-the-radius-was-a-square.eml.md", "title": "The radius was a square", "description": "`the_radius_was_a_square.eml` - A locator lists the stores within 10 km of a customer, and it applies its filter to the real coordinates of every store. What shape 'within 10 km' was implemented as is computed below." }, { "id": "877-the-run-stopped-before-it-had-seen-them-all", "path": "/ai/examples/877-the-run-stopped-before-it-had-seen-them-all.eml.md", "title": "The run stopped before it had seen them all", "description": "`the_run_stopped_before_it_had_seen_them_all.eml` - A fuzzing run draws random inputs that each trigger one of ten equally likely error categories, and after ten draws it reports which categories can occur. Every draw was genuine and every category seen was logged. How many draws it takes to see all ten is computed below." }, { "id": "878-the-runoff-eliminated-the-one-everyone-could-accept", "path": "/ai/examples/878-the-runoff-eliminated-the-one-everyone-could-accept.eml.md", "title": "The runoff eliminated the one everyone could accept", "description": "`the_runoff_eliminated_the_one_everyone_could_accept.eml` - An instant-runoff election counts every ballot exactly and applies its elimination rule to the letter, and a winner emerges with 65 percent in the final round. Which candidate would have beaten every other one head-to-head is computed below." }, { "id": "879-the-sample-was-drawn-with-replacement", "path": "/ai/examples/879-the-sample-was-drawn-with-replacement.eml.md", "title": "The sample was drawn with replacement", "description": "`the_sample_was_drawn_with_replacement.eml` - A quality review examines a random sample of one thousand records out of ten thousand, and every one of the thousand draws is a genuine uniform random pick. How many distinct records the thousand draws reach is computed below." }, { "id": "880-the-shuffle-left-one-in-place-as-expected", "path": "/ai/examples/880-the-shuffle-left-one-in-place-as-expected.eml.md", "title": "The shuffle left one in place as expected", "description": "`the_shuffle_left_one_in_place_as_expected.eml` - A test rejects a shuffle whenever any item is left in its original position, on the grounds that a random shuffle should move everything, and it checks every position of every run exactly. How often a uniform random shuffle leaves something in place is computed below." }, { "id": "881-the-sincere-ballot-lost-to-the-strategic-one", "path": "/ai/examples/881-the-sincere-ballot-lost-to-the-strategic-one.eml.md", "title": "The sincere ballot lost to the strategic one", "description": "`the_sincere_ballot_lost_to_the_strategic_one.eml` - A Borda-count election scores every ranked ballot exactly and elects the highest total, and a clear majority of voters put the same candidate first. What that majority could have won by misreporting its second choice is computed below." }, { "id": "882-both-cut-the-price-and-both-lost", "path": "/ai/examples/882-both-cut-the-price-and-both-lost.eml.md", "title": "Both cut the price and both lost", "description": "`both_cut_the_price_and_both_lost.eml` - Two firms each choose whether to hold or cut their price, each chooses the option that is better for it whatever the other does, and each computes its payoffs correctly. Where two correct best responses land is computed below." }, { "id": "883-dropping-the-loser-kept-its-overhead", "path": "/ai/examples/883-dropping-the-loser-kept-its-overhead.eml.md", "title": "Dropping the loser kept its overhead", "description": "`dropping_the_loser_kept_its_overhead.eml` - A company allocates its fixed overhead across three products in proportion to revenue, finds that product C shows a loss after its share, and drops it. The allocation is the standard method and every figure is real. What leaves with product C, and what stays, is computed below." }, { "id": "884-each-tenant-added-one-more-and-all-of-them-slowed", "path": "/ai/examples/884-each-tenant-added-one-more-and-all-of-them-slowed.eml.md", "title": "Each tenant added one more and all of them slowed", "description": "`each_tenant_added_one_more_and_all_of_them_slowed.eml` - Ten tenants share a cluster, each measures that adding one more worker raises its own throughput, and every measurement is correct. What one tenant's extra worker does to the other nine is computed below." }, { "id": "885-the-average-cost-said-yes-and-the-next-unit-said-no", "path": "/ai/examples/885-the-average-cost-said-yes-and-the-next-unit-said-no.eml.md", "title": "The average cost said yes and the next unit said no", "description": "`the_average_cost_said_yes_and_the_next_unit_said_no.eml` - A plant accepts an order priced above its average cost per unit, the average is computed exactly from real costs, and the order price is real. What the next hundred units actually cost to make is computed below." }, { "id": "886-the-contrast-was-computed-on-the-encoded-values", "path": "/ai/examples/886-the-contrast-was-computed-on-the-encoded-values.eml.md", "title": "The contrast was computed on the encoded values", "description": "`the_contrast_was_computed_on_the_encoded_values.eml` - An accessibility checker computes the contrast ratio of text on its background and rejects pairs below the 4.5 to 1 threshold, and it runs the standard's formula exactly over every pair. What number the formula must be fed is computed below." }, { "id": "887-the-fair-price-drove-out-the-good-risks", "path": "/ai/examples/887-the-fair-price-drove-out-the-good-risks.eml.md", "title": "The fair price drove out the good risks", "description": "`the_fair_price_drove_out_the_good_risks.eml` - An insurer prices a policy at the average expected claim of the whole population, the average is computed exactly from every customer's true risk, and every customer decides rationally whether to buy. Who buys at the average price is computed below." }, { "id": "888-the-gradient-was-averaged-in-srgb", "path": "/ai/examples/888-the-gradient-was-averaged-in-srgb.eml.md", "title": "The gradient was averaged in srgb", "description": "`the_gradient_was_averaged_in_srgb.eml` - A renderer draws a gradient from black to white by averaging the two endpoint pixel values for the middle, and the averaging is exact over every pixel. What the stored pixel values are an encoding of is computed below." }, { "id": "889-the-hues-were-averaged-across-the-wrap", "path": "/ai/examples/889-the-hues-were-averaged-across-the-wrap.eml.md", "title": "The hues were averaged across the wrap", "description": "`the_hues_were_averaged_across_the_wrap.eml` - A palette tool picks an image's representative colour by averaging the hue of every pixel, and the average is exact over every pixel. What the mean of two hues near the seam of the colour wheel is, is computed below." }, { "id": "890-the-money-already-spent-voted-to-finish", "path": "/ai/examples/890-the-money-already-spent-voted-to-finish.eml.md", "title": "The money already spent voted to finish", "description": "`the_money_already_spent_voted_to_finish.eml` - A project is eighty percent through its budget, the spend and the remaining cost are real and exact, and the committee votes to finish rather than waste what was spent. Which numbers actually differ between finishing and stopping is computed below." }, { "id": "891-the-price-rose-ten-percent-and-the-revenue-fell", "path": "/ai/examples/891-the-price-rose-ten-percent-and-the-revenue-fell.eml.md", "title": "The price rose ten percent and the revenue fell", "description": "`the_price_rose_ten_percent_and_the_revenue_fell.eml` - A seller raises its price by ten percent to raise revenue, the increase is applied exactly, and the revenue afterwards is measured exactly. What revenue is a product of is computed below." }, { "id": "892-the-return-was-positive-and-the-alternative-was-better", "path": "/ai/examples/892-the-return-was-positive-and-the-alternative-was-better.eml.md", "title": "The return was positive and the alternative was better", "description": "`the_return_was_positive_and_the_alternative_was_better.eml` - A project returned five percent on its capital, the return is real and correctly measured, and it is reported as a success because it is positive. What the same capital would have returned in the best alternative is computed below." }, { "id": "893-the-shortcut-made-every-commute-longer", "path": "/ai/examples/893-the-shortcut-made-every-commute-longer.eml.md", "title": "The shortcut made every commute longer", "description": "`the_shortcut_made_every_commute_longer.eml` - A city adds a free, instant shortcut between the two halves of its road network, every driver picks the fastest route given everyone else's choice, and the travel times are measured exactly. What the network settles to with the shortcut is computed below." }, { "id": "894-the-thumbnail-skipped-every-other-pixel", "path": "/ai/examples/894-the-thumbnail-skipped-every-other-pixel.eml.md", "title": "The thumbnail skipped every other pixel", "description": "`the_thumbnail_skipped_every_other_pixel.eml` - A thumbnailer halves an image by taking every other pixel in each direction, and it takes exactly the pixels it says it takes, over the whole image. What a picture of fine lines becomes when every other pixel is taken is computed below." }, { "id": "895-the-transparent-pixels-still-had-a-value", "path": "/ai/examples/895-the-transparent-pixels-still-had-a-value.eml.md", "title": "The transparent pixels still had a value", "description": "`the_transparent_pixels_still_had_a_value.eml` - A sprite is drawn with smooth edges by bilinear filtering, and the filter is the engine's own, applied exactly at every edge pixel. What a fully transparent pixel still carries into the filter is computed below." }, { "id": "896-the-winning-bid-was-the-biggest-overestimate", "path": "/ai/examples/896-the-winning-bid-was-the-biggest-overestimate.eml.md", "title": "The winning bid was the biggest overestimate", "description": "`the_winning_bid_was_the_biggest_overestimate.eml` - Five bidders each estimate a tract's value and bid their estimate, every estimate is unbiased, and the auction correctly awards the tract to the highest bid. What is special about the estimate that wins is computed below." }, { "id": "897-each-job-went-to-the-emptiest-machine-and-the-day-ran-long", "path": "/ai/examples/897-each-job-went-to-the-emptiest-machine-and-the-day-ran-long.eml.md", "title": "Each job went to the emptiest machine and the day ran long", "description": "`each_job_went_to_the_emptiest_machine_and_the_day_ran_long.eml` - A dispatcher hands each job, in the order it arrives, to whichever of two machines is least loaded, and every assignment is made exactly by that rule. When the day ends under that rule, against when it could end, is computed below." }, { "id": "898-half-were-vaccinated-and-the-number-stayed-above-one", "path": "/ai/examples/898-half-were-vaccinated-and-the-number-stayed-above-one.eml.md", "title": "Half were vaccinated and the number stayed above one", "description": "`half_were_vaccinated_and_the_number_stayed_above_one.eml` - A campaign vaccinates half the population, the count is exact, the vaccine works, and the plan expects the outbreak to stop. What fraction has to be immune before each case infects fewer than one other is computed below." }, { "id": "899-no-single-change-improved-it-and-two-together-doubled-it", "path": "/ai/examples/899-no-single-change-improved-it-and-two-together-doubled-it.eml.md", "title": "No single change improved it and two together doubled it", "description": "`no_single_change_improved_it_and_two_together_doubled_it.eml` - A tuner adjusts a system one parameter at a time, keeps a change only if the score improves, and stops when no single change helps. Every score it measures is real. What it stops at, against what the system can reach, is computed below." }, { "id": "900-the-average-case-infected-three-and-the-typical-case-none", "path": "/ai/examples/900-the-average-case-infected-three-and-the-typical-case-none.eml.md", "title": "The average case infected three and the typical case none", "description": "`the_average_case_infected_three_and_the_typical_case_none.eml` - Contact tracing finds that each case infects three others on average, the average is exact, and the quarantine plan reserves three beds per case. How the three are distributed across cases is computed below." }, { "id": "901-the-deaths-were-divided-by-todays-cases", "path": "/ai/examples/901-the-deaths-were-divided-by-todays-cases.eml.md", "title": "The deaths were divided by todays cases", "description": "`the_deaths_were_divided_by_todays_cases.eml` - A dashboard reports the fatality rate as today's deaths divided by today's cases, both counts are exact, and during a fast-growing outbreak the rate reads a reassuring half a percent. Which cases today's deaths came from is computed below." }, { "id": "902-the-demand-rose-ten-percent-and-the-factory-saw-eighty", "path": "/ai/examples/902-the-demand-rose-ten-percent-and-the-factory-saw-eighty.eml.md", "title": "The demand rose ten percent and the factory saw eighty", "description": "`the_demand_rose_ten_percent_and_the_factory_saw_eighty.eml` - Customer demand at the shop rises ten percent, and each tier of the supply chain - retailer, wholesaler, factory - orders exactly what its own rule says: cover what it just sold and rebuild one week of safety stock. What the factory sees when every tier applies that rule to the tier below is computed below." }, { "id": "903-the-densest-item-left-the-sack-half-empty", "path": "/ai/examples/903-the-densest-item-left-the-sack-half-empty.eml.md", "title": "The densest item left the sack half empty", "description": "`the_densest_item_left_the_sack_half_empty.eml` - A loader fills a ten-kilo sack by taking items in order of value per kilo, never exceeds the weight limit, and every item it takes is worth exactly what it says. How much value that rule packs, against how much the sack could hold, is computed below." }, { "id": "904-the-earliest-start-took-the-longest-job", "path": "/ai/examples/904-the-earliest-start-took-the-longest-job.eml.md", "title": "The earliest start took the longest job", "description": "`the_earliest_start_took_the_longest_job.eml` - A booking system fills a single room by taking requests in order of start time, never double-books, and every request it takes is a real, valid one. How many requests that rule can fit, against how many the room could hold, is computed below." }, { "id": "905-the-factory-saw-a-season-the-customers-did-not-have", "path": "/ai/examples/905-the-factory-saw-a-season-the-customers-did-not-have.eml.md", "title": "The factory saw a season the customers did not have", "description": "`the_factory_saw_a_season_the_customers_did_not_have.eml` - A factory plans capacity from the orders it receives, the orders are real and exactly recorded, and they show a sharp spike on the first of every month. Where that spike comes from is computed below." }, { "id": "906-the-lead-time-doubled-and-the-reorder-point-did-not", "path": "/ai/examples/906-the-lead-time-doubled-and-the-reorder-point-did-not.eml.md", "title": "The lead time doubled and the reorder point did not", "description": "`the_lead_time_doubled_and_the_reorder_point_did_not.eml` - A warehouse reorders whenever stock falls to a reorder point, the point was set exactly to cover demand during the supplier's lead time, and every reorder fires on time. What happens to that point when the supplier's lead time changes is computed below." }, { "id": "907-the-orders-doubled-because-half-would-be-filled", "path": "/ai/examples/907-the-orders-doubled-because-half-would-be-filled.eml.md", "title": "The orders doubled because half would be filled", "description": "`the_orders_doubled_because_half_would_be_filled.eml` - During a shortage a manufacturer allocates half of every order, reads the order book as demand, and builds capacity to meet it. Every order is real and every allocation is exact. What customers do to their orders when they know half will be filled is computed below." }, { "id": "908-the-policy-was-judged-before-its-infections-were-counted", "path": "/ai/examples/908-the-policy-was-judged-before-its-infections-were-counted.eml.md", "title": "The policy was judged before its infections were counted", "description": "`the_policy_was_judged_before_its_infections_were_counted.eml` - A policy halves new infections from the day it starts, the daily case reports are exact, and five days in the reports show no change - so the policy is judged to have done nothing. Whose infections the day-five report is counting is computed below." }, { "id": "909-the-shortest-path-was-finalised-before-the-rebate", "path": "/ai/examples/909-the-shortest-path-was-finalised-before-the-rebate.eml.md", "title": "The shortest path was finalised before the rebate", "description": "`the_shortest_path_was_finalised_before_the_rebate.eml` - A route planner finds the cheapest way from A to B by always settling the cheapest unsettled point next, and it implements that algorithm exactly. What the algorithm assumes about every road, and which road breaks it, is computed below." }, { "id": "910-the-stock-was-counted-and-the-promises-were-not", "path": "/ai/examples/910-the-stock-was-counted-and-the-promises-were-not.eml.md", "title": "The stock was counted and the promises were not", "description": "`the_stock_was_counted_and_the_promises_were_not.eml` - The sales screen shows 1400 units of stock, the count behind it is exact, and sales staff sell against it. Which of those units can actually be promised to a new customer is computed below." }, { "id": "911-the-two-points-were-joined-by-a-line", "path": "/ai/examples/911-the-two-points-were-joined-by-a-line.eml.md", "title": "The two points were joined by a line", "description": "`the_two_points_were_joined_by_a_line.eml` - Case counts are read on day zero and day three, both readings are exact, and a forecast for day thirty is drawn by extending the line through them. What kind of curve the two points lie on is computed below." }, { "id": "912-eight-workers-made-it-three-times-faster", "path": "/ai/examples/912-eight-workers-made-it-three-times-faster.eml.md", "title": "Eight workers made it three times faster", "description": "`eight_workers_made_it_three_times_faster.eml` - A job that takes an hour on one worker is spread across eight, the parallel part divides perfectly with no coordination cost, and the job now takes twenty minutes. Why eight workers gave three times and not eight is computed below." }, { "id": "913-five-years-of-payments-bought-seven-percent-of-the-house", "path": "/ai/examples/913-five-years-of-payments-bought-seven-percent-of-the-house.eml.md", "title": "Five years of payments bought seven percent of the house", "description": "`five_years_of_payments_bought_seven_percent_of_the_house.eml` - A borrower takes a thirty-year mortgage, makes every one of the first sixty monthly payments in full and on time, and reasons that five years of a thirty-year loan is a sixth of the house paid for. How much of each payment reaches the principal is computed below." }, { "id": "914-half-the-users-was-a-quarter-of-the-value", "path": "/ai/examples/914-half-the-users-was-a-quarter-of-the-value.eml.md", "title": "Half the users was a quarter of the value", "description": "`half_the_users_was_a_quarter_of_the_value.eml` - A messaging network is valued by its user count, a rival has exactly half as many users, and the rival is priced at half. What the users of a network are actually connected by is computed below." }, { "id": "915-the-balance-grew-and-bought-less", "path": "/ai/examples/915-the-balance-grew-and-bought-less.eml.md", "title": "The balance grew and bought less", "description": "`the_balance_grew_and_bought_less.eml` - A saver earns three percent for the year, the interest is real and correctly credited, and the statement shows the balance up by three percent. What that larger balance buys is computed below." }, { "id": "916-the-company-was-profitable-and-could-not-pay-its-staff", "path": "/ai/examples/916-the-company-was-profitable-and-could-not-pay-its-staff.eml.md", "title": "The company was profitable and could not pay its staff", "description": "`the_company_was_profitable_and_could_not_pay_its_staff.eml` - A company delivers work worth 1000 a month at a cost of 800, books a profit of 200 every month, and in month three cannot make payroll. Every entry is real and the profit is correctly computed. When the money the profit is made of actually arrives is computed below." }, { "id": "917-the-cost-moved-to-the-balance-sheet-and-the-profit-rose", "path": "/ai/examples/917-the-cost-moved-to-the-balance-sheet-and-the-profit-rose.eml.md", "title": "The cost moved to the balance sheet and the profit rose", "description": "`the_cost_moved_to_the_balance_sheet_and_the_profit_rose.eml` - A company spends 1000 on development, records it as an asset to be written off over five years instead of as this year's expense, and reports profit up eighty percent. How much cash left the company either way is computed below." }, { "id": "918-the-data-grew-ten-fold-and-the-job-grew-a-hundred", "path": "/ai/examples/918-the-data-grew-ten-fold-and-the-job-grew-a-hundred.eml.md", "title": "The data grew ten fold and the job grew a hundred", "description": "`the_data_grew_ten_fold_and_the_job_grew_a_hundred.eml` - A nightly job finds duplicate records by comparing every record with every other, it runs in a minute on a thousand records, and the plan for ten thousand records allows ten minutes. How the number of comparisons grows with the number of records is computed below." }, { "id": "919-the-internal-price-decided-which-subsidiary-was-profitable", "path": "/ai/examples/919-the-internal-price-decided-which-subsidiary-was-profitable.eml.md", "title": "The internal price decided which subsidiary was profitable", "description": "`the_internal_price_decided_which_subsidiary_was_profitable.eml` - A group has two subsidiaries: one makes a part, the other fits it and sells the product. Each keeps exact books, each reports its own profit, and each manager is paid on it. What the number that moves profit between them is, and who sets it, is computed below." }, { "id": "920-the-oldest-cost-was-charged-first-and-the-profit-was-inflation", "path": "/ai/examples/920-the-oldest-cost-was-charged-first-and-the-profit-was-inflation.eml.md", "title": "The oldest cost was charged first and the profit was inflation", "description": "`the_oldest_cost_was_charged_first_and_the_profit_was_inflation.eml` - A shop buys a hundred units in January at 10 and a hundred in June at 15, sells a hundred in July at 20, and charges the January cost against the sale as its oldest-first method requires. What the profit contains when the units sold are replaced at today's price is computed below." }, { "id": "921-the-rate-was-twelve-percent-and-the-year-cost-more", "path": "/ai/examples/921-the-rate-was-twelve-percent-and-the-year-cost-more.eml.md", "title": "The rate was twelve percent and the year cost more", "description": "`the_rate_was_twelve_percent_and_the_year_cost_more.eml` - A loan is quoted at twelve percent a year, the quote is accurate, and the borrower budgets twelve percent of the principal for the year's interest. What the year actually costs when interest is charged monthly is computed below." }, { "id": "922-the-safe-bond-lost-a-sixth-when-rates-rose", "path": "/ai/examples/922-the-safe-bond-lost-a-sixth-when-rates-rose.eml.md", "title": "The safe bond lost a sixth when rates rose", "description": "`the_safe_bond_lost_a_sixth_when_rates_rose.eml` - A saver buys a ten-year government bond as the safe part of the portfolio, the issuer will certainly pay every coupon and the principal, and the statement a year later shows the bond down sixteen percent. What a bond's price answers to is computed below." }, { "id": "923-the-same-returns-in-a-different-order-left-less", "path": "/ai/examples/923-the-same-returns-in-a-different-order-left-less.eml.md", "title": "The same returns in a different order left less", "description": "`the_same_returns_in_a_different_order_left_less.eml` - Two retirees hold the same fund, earn the same two yearly returns - up twenty and down twenty - and withdraw the same ten at the end of each year. Every return and every withdrawal is real and exactly applied. Why they end with different balances is computed below." }, { "id": "924-the-sixteenth-node-made-the-cluster-slower", "path": "/ai/examples/924-the-sixteenth-node-made-the-cluster-slower.eml.md", "title": "The sixteenth node made the cluster slower", "description": "`the_sixteenth_node_made_the_cluster_slower.eml` - A cluster of eight nodes is doubled to sixteen to raise throughput, every node is identical and fully working, and the sixteen-node cluster does less work per second than the eight. What each added node costs the others is computed below." }, { "id": "925-the-tank-was-twice-as-big-and-the-legs-were-not", "path": "/ai/examples/925-the-tank-was-twice-as-big-and-the-legs-were-not.eml.md", "title": "The tank was twice as big and the legs were not", "description": "`the_tank_was_twice_as_big_and_the_legs_were_not.eml` - A water tank that works is rebuilt at twice the size - every dimension doubled, the same design, the same materials, the same four legs scaled with it - and the legs buckle. How the weight and the legs scale with the size is computed below." }, { "id": "926-the-three-year-contract-was-a-great-first-year", "path": "/ai/examples/926-the-three-year-contract-was-a-great-first-year.eml.md", "title": "The three year contract was a great first year", "description": "`the_three_year_contract_was_a_great_first_year.eml` - A sales team signs a three-year service contract worth 3000, the full amount is booked as this year's revenue, and the year closes with a record profit. Which year the service is actually delivered in is computed below." }, { "id": "927-adjusting-after-every-miss-doubled-the-scatter", "path": "/ai/examples/927-adjusting-after-every-miss-doubled-the-scatter.eml.md", "title": "Adjusting after every miss doubled the scatter", "description": "`adjusting_after_every_miss_doubled_the_scatter.eml` - A filling machine misses its target by a little every time, and after every fill the operator nudges the setting by exactly the amount of the last miss, in the opposite direction. Every measurement is real and every adjustment is arithmetically exact. What such diligence does to the scatter is computed below." }, { "id": "928-eight-points-on-one-side-and-all-of-them-in-limits", "path": "/ai/examples/928-eight-points-on-one-side-and-all-of-them-in-limits.eml.md", "title": "Eight points on one side and all of them in limits", "description": "`eight_points_on_one_side_and_all_of_them_in_limits.eml` - A control chart shows the last eight points all above the centre line, every one of them comfortably inside the three-sigma limits, and the rule in use - a point beyond the limits - has not fired. Every point is real. How likely eight in a row on one side is for a process that has not moved is computed below." }, { "id": "929-every-point-was-in-control-and-a-twentieth-were-out-of-spec", "path": "/ai/examples/929-every-point-was-in-control-and-a-twentieth-were-out-of-spec.eml.md", "title": "Every point was in control and a twentieth were out of spec", "description": "`every_point_was_in_control_and_a_twentieth_were_out_of_spec.eml` - A process runs for a month with every point inside its control limits, the chart is correctly drawn from the process's own spread, and the line reports itself in control. Where the customer's specification sits against those limits is computed below." }, { "id": "930-most-of-the-scatter-was-the-gauge", "path": "/ai/examples/930-most-of-the-scatter-was-the-gauge.eml.md", "title": "Most of the scatter was the gauge", "description": "`most_of_the_scatter_was_the_gauge.eml` - Parts are measured, their scatter is computed exactly, and the process is judged not capable of holding the specification. Every measurement is real. How much of that scatter belongs to the parts and how much to the measuring is computed below." }, { "id": "931-ninety-survive-and-ten-die-were-the-same-number", "path": "/ai/examples/931-ninety-survive-and-ten-die-were-the-same-number.eml.md", "title": "Ninety survive and ten die were the same number", "description": "`ninety_survive_and_ten_die_were_the_same_number.eml` - Patients are told the surgery's outcome either as 'ninety of a hundred survive' or as 'ten of a hundred die'. The two statements are the same statistic, both are true, and the groups are alike. How many choose the surgery under each is computed below." }, { "id": "932-one-in-ten-thousand-per-transaction-was-a-hundred-a-day", "path": "/ai/examples/932-one-in-ten-thousand-per-transaction-was-a-hundred-a-day.eml.md", "title": "One in ten thousand per transaction was a hundred a day", "description": "`one_in_ten_thousand_per_transaction_was_a_hundred_a_day.eml` - A payment step fails one time in ten thousand, the rate is real and well measured, and the failure is filed as rare and left unhandled. How often a rare thing happens to a busy system is computed below." }, { "id": "933-the-crossed-out-price-sold-the-same-price", "path": "/ai/examples/933-the-crossed-out-price-sold-the-same-price.eml.md", "title": "The crossed out price sold the same price", "description": "`the_crossed_out_price_sold_the_same_price.eml` - Two shelf tags offer the same item at the same price, 60; one also shows a crossed-out 100 above it. The price is identical, the counts are real, and the tag with the crossed-out number sells nearly twice as many. What the number that is not the price does is computed below." }, { "id": "934-the-hundred-year-flood-in-a-thirty-year-mortgage", "path": "/ai/examples/934-the-hundred-year-flood-in-a-thirty-year-mortgage.eml.md", "title": "The hundred year flood in a thirty year mortgage", "description": "`the_hundred_year_flood_in_a_thirty_year_mortgage.eml` - A buyer takes a thirty-year mortgage on a house in the hundred-year floodplain, the flood map is correct, and the buyer reasons that a hundred-year flood is not a thirty-year problem. What one percent a year adds up to over thirty years is computed below." }, { "id": "935-the-option-nobody-chose-changed-what-they-chose", "path": "/ai/examples/935-the-option-nobody-chose-changed-what-they-chose.eml.md", "title": "The option nobody chose changed what they chose", "description": "`the_option_nobody_chose_changed_what_they_chose.eml` - A menu offers a small and a large; a medium is added that almost nobody buys; and sales of the large double. Every count is real and the medium really was chosen by almost no one. What an option nobody chooses does to the choice is computed below." }, { "id": "936-the-owners-asked-twice-what-the-buyers-offered", "path": "/ai/examples/936-the-owners-asked-twice-what-the-buyers-offered.eml.md", "title": "The owners asked twice what the buyers offered", "description": "`the_owners_asked_twice_what_the_buyers_offered.eml` - Half a room is handed a mug at random and asked the least they would sell it for; the other half is asked the most they would pay for one. The two halves are the same kind of people and the mug is the same mug. Standard theory says about half should trade. How many trades happen, and why, is computed below." }, { "id": "937-the-return-period-was-read-as-a-schedule", "path": "/ai/examples/937-the-return-period-was-read-as-a-schedule.eml.md", "title": "The return period was read as a schedule", "description": "`the_return_period_was_read_as_a_schedule.eml` - The hundred-year flood came in 1995, the town rebuilt, and the levee plan was deferred on the reasoning that the next one is not due until 2095. The 1995 flood is real and the return period is correctly stated. What the river remembers of 1995 is computed below." }, { "id": "938-the-same-choice-went-from-fifteen-to-eighty-five-when-the-default-flipped", "path": "/ai/examples/938-the-same-choice-went-from-fifteen-to-eighty-five-when-the-default-flipped.eml.md", "title": "The same choice went from fifteen to eighty five when the default flipped", "description": "`the_same_choice_went_from_fifteen_to_eighty_five_when_the_default_flipped.eml` - Two countries offer the same pension plan with the same terms; in one you tick a box to join, in the other you tick a box to leave. Enrolment is fifteen percent in the first and eighty-five in the second. Both figures are real. What the box that is already ticked decides is computed below." }, { "id": "939-the-spread-was-fine-and-the-centre-was-not", "path": "/ai/examples/939-the-spread-was-fine-and-the-centre-was-not.eml.md", "title": "The spread was fine and the centre was not", "description": "`the_spread_was_fine_and_the_centre_was_not.eml` - A process's spread is half the width the specification allows, the capability index on spread reads a comfortable two, and the line signs off on it. Where the process sits inside that specification is computed below." }, { "id": "940-the-thirty-percent-forecast-was-judged-on-one-rainy-day", "path": "/ai/examples/940-the-thirty-percent-forecast-was-judged-on-one-rainy-day.eml.md", "title": "The thirty percent forecast was judged on one rainy day", "description": "`the_thirty_percent_forecast_was_judged_on_one_rainy_day.eml` - The forecast said thirty percent chance of rain, it rained, and the forecast is judged wrong. The forecast was real, the rain was real, and the judgement compared the two exactly. What a probability can be judged against is computed below." }, { "id": "941-the-wall-was-built-to-the-average-of-the-worst-days", "path": "/ai/examples/941-the-wall-was-built-to-the-average-of-the-worst-days.eml.md", "title": "The wall was built to the average of the worst days", "description": "`the_wall_was_built_to_the_average_of_the_worst_days.eml` - A flood wall is built to the average of the ten highest annual water levels on record, the ten readings are real and the average is exact, and the wall is overtopped three years in ten. What an average of maxima is, is computed below." }, { "id": "942-doubling-the-dose-did-not-halve-the-wait", "path": "/ai/examples/942-doubling-the-dose-did-not-halve-the-wait.eml.md", "title": "Doubling the dose did not halve the wait", "description": "`doubling_the_dose_did_not_halve_the_wait.eml` - A patient on a once-a-day drug with a one-day half-life is told it takes about five days to reach its working level, wants it sooner, and reasons that twice the tablet will get there in half the time. What the doubled tablet actually changes is computed below." }, { "id": "943-ten-of-them-were-not-ten-times-as-loud", "path": "/ai/examples/943-ten-of-them-were-not-ten-times-as-loud.eml.md", "title": "Ten of them were not ten times as loud", "description": "`ten_of_them_were_not_ten_times_as_loud.eml` - A restaurant measures sixty decibels with one table talking and eighty with the room full, reads the meter as a third more noise, and buys acoustic panels rated to absorb half the sound in the room. What twenty decibels is in sound energy, and what half the energy is in decibels, is computed below." }, { "id": "944-the-aperture-number-doubled-and-the-light-quartered", "path": "/ai/examples/944-the-aperture-number-doubled-and-the-light-quartered.eml.md", "title": "The aperture number doubled and the light quartered", "description": "`the_aperture_number_doubled_and_the_light_quartered.eml` - A photographer closes the lens from f/2 to f/4 for a brighter scene, doubles the shutter time from 1/500 to 1/250 to pay for it, and reasons that a doubled f-number is half the light so a doubled time restores the exposure. How much light an f-number actually admits is computed below." }, { "id": "945-the-back-row-was-two-stops-dark", "path": "/ai/examples/945-the-back-row-was-two-stops-dark.eml.md", "title": "The back row was two stops dark", "description": "`the_back_row_was_two_stops_dark.eml` - A group photo is lit by one flash on the camera, the front row two metres away and the back row four, the flash is set exactly for the front row, and the photographer reasons that the back row is only two metres further so it will be a little darker. How much darker two more metres make it is computed below." }, { "id": "946-the-dose-was-right-for-a-kidney-that-was-not-his", "path": "/ai/examples/946-the-dose-was-right-for-a-kidney-that-was-not-his.eml.md", "title": "The dose was right for a kidney that was not his", "description": "`the_dose_was_right_for_a_kidney_that_was_not_his.eml` - A patient is prescribed the label dose of a drug that leaves the body through the kidneys, the label is correct, the tablets are taken exactly, and the patient's kidneys clear at half the rate the label was written for. What the same dose becomes at half the clearance is computed below." }, { "id": "947-the-drink-had-no-half-life", "path": "/ai/examples/947-the-drink-had-no-half-life.eml.md", "title": "The drink had no half life", "description": "`the_drink_had_no_half_life.eml` - A driver knows from a painkiller that four times the dose wears off in only twice the time, applies the same rule to four drinks instead of one, and plans the drive home for two hours after the last glass. How the two substances leave the body is computed below." }, { "id": "948-the-ear-could-not-hear-the-difference-and-could-count-it", "path": "/ai/examples/948-the-ear-could-not-hear-the-difference-and-could-count-it.eml.md", "title": "The ear could not hear the difference and could count it", "description": "`the_ear_could_not_hear_the_difference_and_could_count_it.eml` - A violinist tunes the A string to the piano's A by playing them together and listening for a difference in pitch, hears none, and declares the string in tune while it throbs once a second against the piano. What a one-hertz gap sounds like, as a pitch and as a pulse, is computed below." }, { "id": "949-the-fifth-dose-was-the-same-as-the-first-and-the-level-was-double", "path": "/ai/examples/949-the-fifth-dose-was-the-same-as-the-first-and-the-level-was-double.eml.md", "title": "The fifth dose was the same as the first and the level was double", "description": "`the_fifth_dose_was_the_same_as_the_first_and_the_level_was_double.eml` - A patient takes one 160 mg tablet a day of a drug whose half-life is one day, the label is right, every tablet is taken, and the patient reasons that one tablet a day means one tablet's worth in the blood. What yesterday's half adds to today's tablet is computed below." }, { "id": "950-the-lens-did-not-change-the-perspective-and-the-feet-did", "path": "/ai/examples/950-the-lens-did-not-change-the-perspective-and-the-feet-did.eml.md", "title": "The lens did not change the perspective and the feet did", "description": "`the_lens_did_not_change_the_perspective_and_the_feet_did.eml` - A photographer swaps a 50 mm lens for a 100 mm to get the flattering, compressed look of a portrait lens, steps back to keep the subject the same size in the frame, and credits the lens with the change in the background. What the lens changed and what the step back changed is computed below." }, { "id": "951-the-meter-made-the-snow-grey", "path": "/ai/examples/951-the-meter-made-the-snow-grey.eml.md", "title": "The meter made the snow grey", "description": "`the_meter_made_the_snow_grey.eml` - A photographer on a ski slope points a calibrated light meter at the snow, sets the camera to exactly what it reads, and gets a frame of grey snow; the same meter pointed at a coal heap gives grey coal. What the meter assumes about the thing it is pointed at is computed below." }, { "id": "952-the-missed-dose-was-doubled-up-and-the-peak-was-the-problem", "path": "/ai/examples/952-the-missed-dose-was-doubled-up-and-the-peak-was-the-problem.eml.md", "title": "The missed dose was doubled up and the peak was the problem", "description": "`the_missed_dose_was_doubled_up_and_the_peak_was_the_problem.eml` - A patient at steady state on a once-a-day drug misses a day, reasons that the missed tablet is owed and takes two the next morning, and the amount taken over the two days comes out exactly right. Where the two tablets put the peak is computed below." }, { "id": "953-the-same-hundred-hertz-was-a-fifth-and-then-a-third", "path": "/ai/examples/953-the-same-hundred-hertz-was-a-fifth-and-then-a-third.eml.md", "title": "The same hundred hertz was a fifth and then a third", "description": "`the_same_hundred_hertz_was_a_fifth_and_then_a_third.eml` - A synthesizer patch moves a melody up by adding one hundred hertz to every note in its frequency table, every note is moved by exactly the same amount, and the transposed tune comes out as a different tune. What a constant number of hertz does to the intervals is computed below." }, { "id": "954-the-two-notes-shared-every-third-overtone", "path": "/ai/examples/954-the-two-notes-shared-every-third-overtone.eml.md", "title": "The two notes shared every third overtone", "description": "`the_two_notes_shared_every_third_overtone.eml` - A sound designer thickens a 220 Hz tone by layering a second tone just above it at 233 Hz, both tones clean, both with the same overtone structure, and the layer comes out rough and beating instead of thick. Where the overtones of two tones land on each other, and where they narrowly miss, is computed below." }, { "id": "955-twelve-fifths-did-not-make-seven-octaves", "path": "/ai/examples/955-twelve-fifths-did-not-make-seven-octaves.eml.md", "title": "Twelve fifths did not make seven octaves", "description": "`twelve_fifths_did_not_make_seven_octaves.eml` - A tuner sets a keyboard by pure fifths, each one checked beatless at exactly three to two, twelve of them around the circle from C back to C, and reasons that twelve fifths climb seven octaves so the last note will match the first. What twelve exact fifths actually climb is computed below." }, { "id": "956-two-safe-changes-made-two-stops", "path": "/ai/examples/956-two-safe-changes-made-two-stops.eml.md", "title": "Two safe changes made two stops", "description": "`two_safe_changes_made_two_stops.eml` - A photographer metered a portrait at f/8 and 1/125, opened the aperture one stop to soften the background, and slowed the shutter one stop as well, to be safe in the shade. Each change was one careful stop. What two careful stops in the same direction add up to is computed below." }, { "id": "957-each-heater-was-within-the-rating-and-together-they-were-not", "path": "/ai/examples/957-each-heater-was-within-the-rating-and-together-they-were-not.eml.md", "title": "Each heater was within the rating and together they were not", "description": "`each_heater_was_within_the_rating_and_together_they_were_not.eml` - A four-socket extension lead is rated at ten amps, two 1500-watt heaters are plugged into it, each heater draws well under the rating, and the lead's plug melts. What two loads on one lead draw together is computed below." }, { "id": "958-half-the-voltage-was-a-quarter-of-the-heat", "path": "/ai/examples/958-half-the-voltage-was-a-quarter-of-the-heat.eml.md", "title": "Half the voltage was a quarter of the heat", "description": "`half_the_voltage_was_a_quarter_of_the_heat.eml` - A 2000-watt heater built for a 240-volt country is plugged into a 120-volt supply with a plug adapter, the traveller reasons that half the voltage means half the heat and a slow but working heater, and the room barely warms. What half the voltage does to a fixed resistance is computed below." }, { "id": "959-the-heater-was-a-hundred-percent-efficient-and-lost", "path": "/ai/examples/959-the-heater-was-a-hundred-percent-efficient-and-lost.eml.md", "title": "The heater was a hundred percent efficient and lost", "description": "`the_heater_was_a_hundred_percent_efficient_and_lost.eml` - A buyer chooses an electric resistance heater over a heat pump because the heater is rated one hundred percent efficient and nothing can beat one hundred percent, the rating is true, and the heat pump next door delivers three times the heat for the same electricity. What efficiency measures, and what it does not, is computed below." }, { "id": "960-the-house-that-cooled-overnight-lost-less", "path": "/ai/examples/960-the-house-that-cooled-overnight-lost-less.eml.md", "title": "The house that cooled overnight lost less", "description": "`the_house_that_cooled_overnight_lost_less.eml` - A household keeps the heating on all night because reheating a cold house in the morning is said to cost more than the heat saved, the reasoning is repeated by the neighbours, and the meter says the opposite. What a house loses at each temperature, and what reheating actually pays for, is computed below." }, { "id": "961-the-ice-at-zero-did-four-times-the-work-of-water-at-zero", "path": "/ai/examples/961-the-ice-at-zero-did-four-times-the-work-of-water-at-zero.eml.md", "title": "The ice at zero did four times the work of water at zero", "description": "`the_ice_at_zero_did_four_times_the_work_of_water_at_zero.eml` - A host chilling drinks has ice at zero degrees and iced water at zero degrees, reasons that two things at the same temperature cool the same, pours the water in to avoid dilution, and the drinks stay warm. What a hundred grams at zero can absorb, as ice and as water, is computed below." }, { "id": "962-the-insulation-was-doubled-and-the-heat-left-by-the-glass", "path": "/ai/examples/962-the-insulation-was-doubled-and-the-heat-left-by-the-glass.eml.md", "title": "The insulation was doubled and the heat left by the glass", "description": "`the_insulation_was_doubled_and_the_heat_left_by_the_glass.eml` - A house loses heat through a hundred square metres of wall and twenty of glass, the owner doubles the wall insulation because the walls are five times the area, the work is done well, and the heating bill falls by a sixth. Where the heat was actually leaving is computed below." }, { "id": "963-the-long-cord-took-its-share-of-the-heat", "path": "/ai/examples/963-the-long-cord-took-its-share-of-the-heat.eml.md", "title": "The long cord took its share of the heat", "description": "`the_long_cord_took_its_share_of_the_heat.eml` - A 2300-watt heater is run at the end of a fifty-metre extension cord of thin wire, the cord is rated for the current, the heater is rated for the supply, and the room heats slowly while the cord grows warm along its whole length. Where the missing heat went is computed below." }, { "id": "964-the-roast-eight-times-the-size-took-four-times-the-time", "path": "/ai/examples/964-the-roast-eight-times-the-size-took-four-times-the-time.eml.md", "title": "The roast eight times the size took four times the time", "description": "`the_roast_eight_times_the_size_took_four_times_the_time.eml` - A cook who knows a one-kilogram joint takes thirty minutes scales the recipe to an eight- kilogram joint of the same shape, multiplies the time by eight, and takes it out dry and grey two hours after it was done. How cooking time grows with the size of the joint is computed below." }, { "id": "965-the-room-was-dry-and-the-cold-pane-was-wet", "path": "/ai/examples/965-the-room-was-dry-and-the-cold-pane-was-wet.eml.md", "title": "The room was dry and the cold pane was wet", "description": "`the_room_was_dry_and_the_cold_pane_was_wet.eml` - A room reads sixty percent humidity on a good hygrometer, comfortably dry, and every morning the inside of its single-glazed window is streaming. What the same air is at the temperature of the glass is computed below." }, { "id": "966-the-same-spoon-held-twice-the-seasoning", "path": "/ai/examples/966-the-same-spoon-held-twice-the-seasoning.eml.md", "title": "The same spoon held twice the seasoning", "description": "`the_same_spoon_held_twice_the_seasoning.eml` - A recipe written for coarse flake salt calls for two teaspoons, a cook measures two level teaspoons of fine table salt with the same spoon, and the dish is twice as salty as intended. What a teaspoon of each holds is computed below." }, { "id": "967-the-second-batch-went-into-the-same-pan-and-steamed", "path": "/ai/examples/967-the-second-batch-went-into-the-same-pan-and-steamed.eml.md", "title": "The second batch went into the same pan and steamed", "description": "`the_second_batch_went_into_the_same_pan_and_steamed.eml` - A cook doubles a stir-fry for guests, puts the whole six hundred grams into the same pan on the same burner that seared three hundred perfectly, and gets a pan of grey, wet vegetables. What the same burner can do to twice the food is computed below." }, { "id": "968-the-standby-light-was-on-for-twenty-two-hours", "path": "/ai/examples/968-the-standby-light-was-on-for-twenty-two-hours.eml.md", "title": "The standby light was on for twenty two hours", "description": "`the_standby_light_was_on_for_twenty_two_hours.eml` - A household compares a television's hundred watts in use with its five watts on standby, calls the standby a twentieth and not worth a switch, and the meter says the standby is more than half of what the set uses. What five watts for twenty-two hours adds up to is computed below." }, { "id": "969-the-ten-thousand-milliamp-hours-were-at-another-voltage", "path": "/ai/examples/969-the-ten-thousand-milliamp-hours-were-at-another-voltage.eml.md", "title": "The ten thousand milliamp hours were at another voltage", "description": "`the_ten_thousand_milliamp_hours_were_at_another_voltage.eml` - A power bank is labelled 10000 mAh, a phone battery is labelled 3000 mAh, the buyer divides one by the other and expects three full charges and a third, and gets two and a bit. What a milliamp-hour is, and what it is not, is computed below." }, { "id": "970-the-thermometer-said-rare-and-the-plate-said-medium", "path": "/ai/examples/970-the-thermometer-said-rare-and-the-plate-said-medium.eml.md", "title": "The thermometer said rare and the plate said medium", "description": "`the_thermometer_said_rare_and_the_plate_said_medium.eml` - A cook wants a large roast at fifty-seven degrees in the centre, medium-rare, probes it with an accurate thermometer, pulls it from the oven the moment the centre reads fifty-seven, rests it, and carves it at sixty-four. Where the extra seven degrees came from after the oven was gone is computed below." }, { "id": "971-the-water-boiled-at-ninety", "path": "/ai/examples/971-the-water-boiled-at-ninety.eml.md", "title": "The water boiled at ninety", "description": "`the_water_boiled_at_ninety.eml` - A recipe says 'boil for ten minutes', a cook at three thousand metres brings the pot to a rolling boil and times ten minutes to the second, and the food comes out underdone. What 'boiling' means at altitude, and what it means in a pressure cooker, is computed below." }, { "id": "972-an-orbit-of-exactly-one-day-slid-a-degree-west-each-day", "path": "/ai/examples/972-an-orbit-of-exactly-one-day-slid-a-degree-west-each-day.eml.md", "title": "An orbit of exactly one day slid a degree west each day", "description": "`an_orbit_of_exactly_one_day_slid_a_degree_west_each_day.eml` - An operator places a relay satellite in a circular orbit over the equator and tunes its period to exactly one day, 86400 seconds, so that it will hang over the same longitude. How long the Earth really takes to turn once, and where the satellite goes, is computed below." }, { "id": "973-her-brother-had-it-and-her-sons-risk-was-one-in-four", "path": "/ai/examples/973-her-brother-had-it-and-her-sons-risk-was-one-in-four.eml.md", "title": "Her brother had it and her sons risk was one in four", "description": "`her_brother_had_it_and_her_sons_risk_was_one_in_four.eml` - A woman's brother and her mother's brother both have an X-linked recessive condition. She is unaffected, and so are her mother and father. She reasons that the condition shows up in the family's men, never its women, that nothing could have come through her unaffected father, and that her sons' risk is the population's, one boy in 5000. Her sons' real risk is computed below." }, { "id": "974-one-in-twenty-five-carried-what-one-in-twenty-five-hundred-had", "path": "/ai/examples/974-one-in-twenty-five-carried-what-one-in-twenty-five-hundred-had.eml.md", "title": "One in twenty five carried what one in twenty five hundred had", "description": "`one_in_twenty_five_carried_what_one_in_twenty_five_hundred_had.eml` - A screening planner reads that a recessive condition affects one person in 2500 and reasons that its carriers - people with a single copy of the gene - must be rare as well, a handful in a town of 10000, not worth a carrier screen. How common the carriers really are is computed below." }, { "id": "975-the-car-ten-over-was-doing-forty-three-where-the-other-stopped", "path": "/ai/examples/975-the-car-ten-over-was-doing-forty-three-where-the-other-stopped.eml.md", "title": "The car ten over was doing forty three where the other stopped", "description": "`the_car_ten_over_was_doing_forty_three_where_the_other_stopped.eml` - A crate falls off a truck 34.6 metres ahead of two cars. The car at the 50 km/h limit stops just short of it; the driver of the car at 60 had reasoned that ten over is only a fifth faster and would need only about a fifth more road to stop. How fast the second car is still going when it reaches the crate is computed below." }, { "id": "976-the-chaser-slowed-down-to-catch-up", "path": "/ai/examples/976-the-chaser-slowed-down-to-catch-up.eml.md", "title": "The chaser slowed down to catch up", "description": "`the_chaser_slowed_down_to_catch_up.eml` - A pilot flying a spacecraft in a circular orbit is 94 km behind a station in the same orbit and fires the engine forward to catch up, the way any driver closes on the car ahead. What adding speed does to an orbit, and what closes the gap, is computed below." }, { "id": "977-the-cousins-shared-an-eighth-and-the-risk-was-four-times", "path": "/ai/examples/977-the-cousins-shared-an-eighth-and-the-risk-was-four-times.eml.md", "title": "The cousins shared an eighth and the risk was four times", "description": "`the_cousins_shared_an_eighth_and_the_risk_was_four_times.eml` - Two first cousins planning a child reason that cousins share only one gene in eight by descent, that the other seven in eight are as unrelated as any couple's, and that the extra risk of a recessive condition must therefore be about an eighth. What sharing grandparents does to that risk is computed below." }, { "id": "978-the-crew-was-weightless-at-nine-tenths-of-the-gravity", "path": "/ai/examples/978-the-crew-was-weightless-at-nine-tenths-of-the-gravity.eml.md", "title": "The crew was weightless at nine tenths of the gravity", "description": "`the_crew_was_weightless_at_nine_tenths_of_the_gravity.eml` - A visitor watching the crew of a space station float across the cabin reasons that the station is high enough to be out of the Earth's gravity. How much of the gravity is still there at 400 kilometres, and why the crew floats anyway, is computed below." }, { "id": "979-the-earth-was-closest-to-the-sun-in-the-northern-winter", "path": "/ai/examples/979-the-earth-was-closest-to-the-sun-in-the-northern-winter.eml.md", "title": "The earth was closest to the sun in the northern winter", "description": "`the_earth_was_closest_to_the_sun_in_the_northern_winter.eml` - A student at 50 degrees north knows that the Earth's orbit is an ellipse, that the distance to the Sun changes through the year, and that sunlight falls with the square of the distance, and concludes that summer is when the Earth is nearest the Sun. When the Earth is nearest, and how much that matters, is computed below." }, { "id": "980-the-head-on-at-fifty-each-hit-like-fifty-not-a-hundred", "path": "/ai/examples/980-the-head-on-at-fifty-each-hit-like-fifty-not-a-hundred.eml.md", "title": "The head on at fifty each hit like fifty not a hundred", "description": "`the_head_on_at_fifty_each_hit_like_fifty_not_a_hundred.eml` - A road-safety talk describes two identical 1500 kg cars meeting head-on at 50 km/h each, adds the speeds to a closing speed of 100, and tells the audience that each driver takes the crash of hitting a wall at 100. What each car actually goes through, and when the closing speed does matter, is computed below." }, { "id": "981-the-maternal-line-was-one-ancestor-in-a-thousand-and-twenty-four", "path": "/ai/examples/981-the-maternal-line-was-one-ancestor-in-a-thousand-and-twenty-four.eml.md", "title": "The maternal line was one ancestor in a thousand and twenty four", "description": "`the_maternal_line_was_one_ancestor_in_a_thousand_and_twenty_four.eml` - A customer takes a mitochondrial DNA test, which reads DNA passed from mother to child and from no one else. The report traces the maternal line ten generations back to one region, and the customer concludes that this is where their ancestors came from. How many of those ancestors the line passes through is computed below." }, { "id": "982-the-pump-five-cents-lower-was-twenty-kilometres-away", "path": "/ai/examples/982-the-pump-five-cents-lower-was-twenty-kilometres-away.eml.md", "title": "The pump five cents lower was twenty kilometres away", "description": "`the_pump_five_cents_lower_was_twenty_kilometres_away.eml` - A driver sees that a station in the next town, 20 km away, sells petrol 5 cents a litre cheaper than the one at home, drives there to fill 40 litres, and books 2.00 saved on every fill. What the trip itself costs is computed below." }, { "id": "983-the-rising-moon-was-the-farther-one", "path": "/ai/examples/983-the-rising-moon-was-the-farther-one.eml.md", "title": "The rising moon was the farther one", "description": "`the_rising_moon_was_the_farther_one.eml` - An observer sees the full Moon rise huge over the rooftops and, hours later, small and high overhead, and concludes that the rising Moon is the bigger one. How far away the Moon is in each position, and how wide it really is on the sky, is computed below." }, { "id": "984-the-taller-tyres-made-every-kilometre-read-short", "path": "/ai/examples/984-the-taller-tyres-made-every-kilometre-read-short.eml.md", "title": "The taller tyres made every kilometre read short", "description": "`the_taller_tyres_made_every_kilometre_read_short.eml` - A driver replaces 205/55 R16 tyres with taller 225/60 R16 ones on the same rims, keeps the needle at the 100 km/h limit on the motorway, and reasons that the speedometer shows the car's speed and reads a little high anyway. What the needle means on the new tyres is computed below." }, { "id": "985-the-unaffected-sibling-was-a-carrier-two-times-in-three", "path": "/ai/examples/985-the-unaffected-sibling-was-a-carrier-two-times-in-three.eml.md", "title": "The unaffected sibling was a carrier two times in three", "description": "`the_unaffected_sibling_was_a_carrier_two_times_in_three.eml` - Two parents who are both carriers of a recessive condition have one affected child. Their other child is unaffected and, planning a family, is told the textbook figure: a child of two carriers is a carrier one time in two. What being unaffected does to that figure is computed below." }, { "id": "986-the-van-gaining-four-saved-more-than-the-hybrid-gaining-twenty", "path": "/ai/examples/986-the-van-gaining-four-saved-more-than-the-hybrid-gaining-twenty.eml.md", "title": "The van gaining four saved more than the hybrid gaining twenty", "description": "`the_van_gaining_four_saved_more_than_the_hybrid_gaining_twenty.eml` - A household with two cars, each driven 10000 km a year, can afford to replace one. The van does 8 km per litre and its replacement would do 12; the sedan does 20 and a hybrid would do 40. The household reasons that a gain of 20 km per litre is five times a gain of 4 and replaces the sedan. Which swap saves more fuel is computed below." }, { "id": "987-a-forest-cut-to-one-part-in-ten-kept-over-half-its-species", "path": "/ai/examples/987-a-forest-cut-to-one-part-in-ten-kept-over-half-its-species.eml.md", "title": "A forest cut to one part in ten kept over half its species", "description": "`a_forest_cut_to_one_part_in_ten_kept_over_half_its_species.eml` - A land trust can afford to protect only a tenth of a forest that holds 400 species. Its board reasons that species are spread through the forest, so a tenth of the land holds about a tenth of them, 40 species, and votes the purchase down as not worth the money. How many species a tenth of the forest keeps is computed below." }, { "id": "988-a-thousand-animals-bred-like-forty", "path": "/ai/examples/988-a-thousand-animals-bred-like-forty.eml.md", "title": "A thousand animals bred like forty", "description": "`a_thousand_animals_bred_like_forty.eml` - A reserve holds 1000 animals of a species in which a few dominant males father all the young: this season 10 males and 990 females breed. The manager reasons that 1000 animals is well above the few hundred usually quoted as enough to keep a population's genetic variety, and marks the herd as genetically safe. How fast the herd really loses its variety is computed below." }, { "id": "989-equal-grams-of-hydrogen-and-oxygen-were-sixteen-moles-to-one", "path": "/ai/examples/989-equal-grams-of-hydrogen-and-oxygen-were-sixteen-moles-to-one.eml.md", "title": "Equal grams of hydrogen and oxygen were sixteen moles to one", "description": "`equal_grams_of_hydrogen_and_oxygen_were_sixteen_moles_to_one.eml` - A student running a small fuel cell feeds it 16 g of hydrogen and 16 g of oxygen, reasoning that equal amounts of the two reactants will be used up together and all 32 g will become water. How much water the cell can really make, and what is left over, is computed below." }, { "id": "990-half-a-litre-and-half-a-litre-made-less-than-a-litre", "path": "/ai/examples/990-half-a-litre-and-half-a-litre-made-less-than-a-litre.eml.md", "title": "Half a litre and half a litre made less than a litre", "description": "`half_a_litre_and_half_a_litre_made_less_than_a_litre.eml` - A technician pours half a litre of ethanol and half a litre of water into a one-litre flask and expects the mixture to reach the mark exactly, reasoning that nothing escapes, nothing reacts, and 500 plus 500 is 1000. Where the mixture really comes to is computed below." }, { "id": "991-the-cistern-lost-its-top-half-far-faster-than-its-bottom-half", "path": "/ai/examples/991-the-cistern-lost-its-top-half-far-faster-than-its-bottom-half.eml.md", "title": "The cistern lost its top half far faster than its bottom half", "description": "`the_cistern_lost_its_top_half_far_faster_than_its_bottom_half.eml` - A straight-sided cistern empties through a hole in its floor in exactly 600 seconds from full. The caretaker reasons that half the water leaves in half the time and sets the refill valve to open at 300 seconds, when the cistern should be half full. How much water is really left at 300 seconds is computed below." }, { "id": "992-the-fine-sand-drew-the-water-higher-than-the-gravel", "path": "/ai/examples/992-the-fine-sand-drew-the-water-higher-than-the-gravel.eml.md", "title": "The fine sand drew the water higher than the gravel", "description": "`the_fine_sand_drew_the_water_higher_than_the_gravel.eml` - A builder laying a floor slab over damp ground must choose the layer beneath it, and chooses fine sand over coarse gravel, reasoning that sand packs tight with tiny gaps while gravel is full of big holes, so sand will let less water up to the slab. How high water climbs in each is computed below." }, { "id": "993-the-firebreaks-took-four-percent-of-the-woodland-and-half-its-interior", "path": "/ai/examples/993-the-firebreaks-took-four-percent-of-the-woodland-and-half-its-interior.eml.md", "title": "The firebreaks took four percent of the woodland and half its interior", "description": "`the_firebreaks_took_four_percent_of_the_woodland_and_half_its_interior.eml` - A forester cuts two firebreaks, each 40 metres wide, crossing through the middle of a woodland 2 km on a side, and reasons that they take only 4 percent of the trees, leaving 96 percent of the woodland for its wildlife. How much of the habitat the deep- woodland species need is left is computed below." }, { "id": "994-the-fullest-lake-gave-the-smallest-harvest", "path": "/ai/examples/994-the-fullest-lake-gave-the-smallest-harvest.eml.md", "title": "The fullest lake gave the smallest harvest", "description": "`the_fullest_lake_gave_the_smallest_harvest.eml` - A fishery manager surveys a lake whose fish stock stands at 9000 tonnes, close to the 10000 it can hold, and reasons that the fuller the lake, the more fish breed, so the fullest lake supports the biggest catch the fishery can keep taking every year. What the lake can really give each year at each stock is computed below." }, { "id": "995-the-gas-law-was-applied-in-celsius", "path": "/ai/examples/995-the-gas-law-was-applied-in-celsius.eml.md", "title": "The gas law was applied in celsius", "description": "`the_gas_law_was_applied_in_celsius.eml` - An operator watches the absolute pressure gauge on a sealed gas vessel climb from 200 kPa at 20 degrees Celsius to 300 kPa. Knowing that the pressure of a sealed gas is proportional to its temperature, the operator reasons that pressure up by half means temperature up by half - from 20 to 30 degrees, warm but safe. The gas really reached a temperature computed below." }, { "id": "996-the-methane-burned-into-nearly-three-times-its-mass", "path": "/ai/examples/996-the-methane-burned-into-nearly-three-times-its-mass.eml.md", "title": "The methane burned into nearly three times its mass", "description": "`the_methane_burned_into_nearly_three_times_its_mass.eml` - A household burns 1000 kg of natural gas - methane - in a year, and a report says that makes 2750 kg of carbon dioxide. A neighbour objects: mass is conserved, so burning 1000 kg of gas cannot produce more than 1000 kg of anything. What burning really produces is computed below." }, { "id": "997-the-most-at-the-feeder-was-forty-and-the-flock-was-three-hundred", "path": "/ai/examples/997-the-most-at-the-feeder-was-forty-and-the-flock-was-three-hundred.eml.md", "title": "The most at the feeder was forty and the flock was three hundred", "description": "`the_most_at_the_feeder_was_forty_and_the_flock_was_three_hundred.eml` - A birdwatcher counts the finches at a garden feeder every hour for a week; the most ever present at once is 40, and the watcher concludes that the local flock is 40 birds. How many birds actually use the feeder is computed below." }, { "id": "998-the-stone-thrown-from-the-boat-lowered-the-pond", "path": "/ai/examples/998-the-stone-thrown-from-the-boat-lowered-the-pond.eml.md", "title": "The stone thrown from the boat lowered the pond", "description": "`the_stone_thrown_from_the_boat_lowered_the_pond.eml` - Someone sitting in a small boat on a 10 square metre garden pond heaves a 100 kg stone over the side and reasons that the pond will rise, because the stone now takes up 40 litres of room under the water. Which way the pond level moves is computed below." }, { "id": "999-the-thirtieth-dilution-held-no-molecule-at-all", "path": "/ai/examples/999-the-thirtieth-dilution-held-no-molecule-at-all.eml.md", "title": "The thirtieth dilution held no molecule at all", "description": "`the_thirtieth_dilution_held_no_molecule_at_all.eml` - A lab protocol makes a trace standard by diluting a 1 mole-per-litre stock ten-fold, tube after tube, thirty times. The analyst reasons that each tube keeps a tenth of the one before, a tenth of something is still something, and the thirtieth tube holds the compound at 10 to the minus 30 moles per litre - tiny, but there. What a litre of each tube really holds is computed below." }, { "id": "1000-the-tube-two-thirds-as-wide-passed-a-fifth-as-much", "path": "/ai/examples/1000-the-tube-two-thirds-as-wide-passed-a-fifth-as-much.eml.md", "title": "The tube two thirds as wide passed a fifth as much", "description": "`the_tube_two_thirds_as_wide_passed_a_fifth_as_much.eml` - A lubrication line feeds thick oil through a 3 mm bore tube at 900 mL a minute. The only spare tube has a 2 mm bore, and the technician reasons that flow goes with the area of the opening, so two-thirds the bore passes four-ninths of the oil and the job will take a little over twice as long. What the thinner tube really passes is computed below." }, { "id": "1001-three-litres-in-a-thin-tube-split-the-barrel", "path": "/ai/examples/1001-three-litres-in-a-thin-tube-split-the-barrel.eml.md", "title": "Three litres in a thin tube split the barrel", "description": "`three_litres_in_a_thin_tube_split_the_barrel.eml` - A sealed barrel full of water has a thin tube, 10 metres tall, fitted into its lid. Someone pours 3 litres of water into the tube and reasons that 3 litres on top of the 200 the barrel already holds, weighing 3 kg, cannot trouble a barrel built for 200 kg. What the 3 litres do to the lid is computed below." }, { "id": "1002-the-crate-on-its-small-end-slid-no-easier", "path": "/ai/examples/1002-the-crate-on-its-small-end-slid-no-easier.eml.md", "title": "The crate on its small end slid no easier", "description": "`the_crate_on_its_small_end_slid_no_easier.eml` - Two movers must slide a 60 kg crate across a warehouse floor. Lying flat it touches the floor with 5000 square centimetres; one mover stands it on its small end, 1000 square centimetres, and reasons that with a fifth of the surface rubbing, it will slide with a fifth of the push. What the push really is is computed below." }, { "id": "1003-the-four-rope-block-let-one-hauler-do-four-mens-lifting-in-four-times-the-time", "path": "/ai/examples/1003-the-four-rope-block-let-one-hauler-do-four-mens-lifting-in-four-times-the-time.eml.md", "title": "The four rope block let one hauler do four mens lifting in four times the time", "description": "`the_four_rope_block_let_one_hauler_do_four_mens_lifting_in_four_times_the_time.eml` - A crew must raise 20 loads of 200 kg each 3 metres onto a platform. Four haulers lifting on one rope can do it; the foreman fits a four-rope pulley block instead and reasons that since the block quarters the pull, one hauler now does the work of four, and the job will take the same time with one person. How long it really takes is computed below." }, { "id": "1004-the-same-push-on-the-longer-bar-snapped-the-bolt", "path": "/ai/examples/1004-the-same-push-on-the-longer-bar-snapped-the-bolt.eml.md", "title": "The same push on the longer bar snapped the bolt", "description": "`the_same_push_on_the_longer_bar_snapped_the_bolt.eml` - A mechanic frees a seized nut with a 75 cm bar, then tightens the new bolt with the same bar and the same firm push used every day on a 25 cm wrench - a push that always gives the specified 100 newton-metres. How tight the bolt really goes is computed below." }, { "id": "1005-the-solid-wheel-beat-the-ring-down-the-slope", "path": "/ai/examples/1005-the-solid-wheel-beat-the-ring-down-the-slope.eml.md", "title": "The solid wheel beat the ring down the slope", "description": "`the_solid_wheel_beat_the_ring_down_the_slope.eml` - A teacher rolls a solid disc and a thin ring of the same mass and the same radius down the same slope from a height of 2 metres, and predicts a dead heat: everything falls together, and the two have the same mass, size, height and slope. Which one arrives first, and why, is computed below." } ], "tools": { "guide": "/ai/tools/tools.md", "catalog": "/ai/tools/tool-catalog.json", "openapi": "/ai/tools/openapi.json", "health": "/ai/tools/health", "docs": { "parse": "/ai/tools/parse.md", "transpile_python": "/ai/tools/transpile-python.md", "transpile_eml": "/ai/tools/transpile-eml.md", "interpret": "/ai/tools/interpret.md", "trace": "/ai/tools/trace.md", "roundtrip": "/ai/tools/roundtrip.md" }, "available": [ "eml.parse", "eml.transpile_python", "eml.transpile_eml", "eml.interpret", "eml.trace", "eml.roundtrip" ], "limits": { "max_source_length": 20000, "allow_network": false, "allow_filesystem": false, "allow_shell": false, "arbitrary_code_execution": false } }, "changelog": "/ai/changelog/index.md", "snapshots": [ { "id": "latest", "path": "/ai/snapshots/latest.md" }, { "id": "2026-06-30-site-state", "path": "/ai/snapshots/2026-06-30-eml-site-state.md" }, { "id": "2026-06-30-public-corpus", "path": "/ai/snapshots/2026-06-30-eml-public-corpus.jsonl", "format": "jsonl" } ], "reading_order": [ "/ai/index.md", "/ai/corpus/eml-origin.md", "/ai/corpus/eml-current.md", "/ai/specs/eml-v1.md", "/ai/specs/eml-grammar.ebnf", "/ai/examples/001-summation.eml.md", "/ai/tools/tool-catalog.json" ], "agent_guidance": [ "Fetch this manifest first, then follow reading_order.", "Prefer structured schemas (AST/trace/error) over UI text.", "ASCII canonical form is normative; Unicode (Σ ∈ ⇒ ²) is a display projection.", "Do not infer unsupported syntax; the EBNF grammar is the authority.", "Call tools only with bounded EML input (<= 20000 chars).", "Function definitions, class, @cold, @hot, and matrices (/np.array) are fully round-trippable. Only @temporal_loop and async/await remain forward-only (not round-trippable). @hot joined the round-trippable set once the reverse lexer learned to read its marker comment; it was previously listed as a permanent exception." ], "projects": [ { "id": "P001", "slug": "todo-list", "key": "P001-todo-list", "title": "Todo list", "summary": "Add tasks with a priority, mark them done, delete them, and list them in the order added, by priority, or only the ones still pending - from a text menu.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P001-todo-list/" }, { "id": "P002", "slug": "unit-converter", "key": "P002-unit-converter", "title": "Unit converter", "summary": "Convert lengths, weights, temperatures and volumes from any unit to any other of the same kind, and back again, with every typed unit and value checked first - from a text menu.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P002-unit-converter/" }, { "id": "P003", "slug": "expense-tracker", "key": "P003-expense-tracker", "title": "Expense tracker", "summary": "Record income and expenses by date and category, in whole cents, and see the balance, the totals by category and a report for any month - from a text menu.", "modules": 4, "sessions": 2, "path": "/eml-p/projects/P003-expense-tracker/" }, { "id": "P004", "slug": "contacts", "key": "P004-contacts", "title": "Contacts", "summary": "Add, find, edit and delete contacts, kept in name order by binary search; find by part of a name or part of a number, with every phone number checked - from a text menu.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P004-contacts/" }, { "id": "P005", "slug": "gradebook", "key": "P005-gradebook", "title": "Gradebook", "summary": "Students and their scores in three subjects: report cards, a ranking where equal averages share a place, pass or fail, and the class average and median, all worked out exactly - from a text menu.", "modules": 4, "sessions": 2, "path": "/eml-p/projects/P005-gradebook/" }, { "id": "P006", "slug": "inventory", "key": "P006-inventory", "title": "Inventory", "summary": "Items with a unit cost and a safety level, stock received and shipped with every movement logged, a warning for anything below its safety level, and the value of the whole stock - from a text menu.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P006-inventory/" }, { "id": "P007", "slug": "calculator", "key": "P007-calculator", "title": "Calculator", "summary": "Type an expression with + - * / and parentheses; it is turned into postfix and worked out on a stack in exact fractions, so 0.1 + 0.2 is 0.3. Clear error messages, a history and ans for the last answer.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P007-calculator/" }, { "id": "P008", "slug": "number-guessing", "key": "P008-number-guessing", "title": "Number guessing", "summary": "Guess the number at three levels, with higher/lower hints that narrow to a range, a limited number of guesses and a best score per level; the secret numbers come from a random generator written in EML - from a text menu.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P008-number-guessing/" }, { "id": "P009", "slug": "tic-tac-toe", "key": "P009-tic-tac-toe", "title": "Tic-tac-toe", "summary": "Play tic-tac-toe against a friend or against the computer, which wins when it can and blocks when it must; wins and draws are found and a running score is kept - from a text menu.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P009-tic-tac-toe/" }, { "id": "P010", "slug": "quiz", "key": "P010-quiz", "title": "Quiz", "summary": "Take a multiple-choice quiz, get a score, review the questions you missed and retake only those until none are left; every attempt is kept in a score history - from a text menu.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P010-quiz/" }, { "id": "P011", "slug": "shopping-cart", "key": "P011-shopping-cart", "title": "Shopping cart", "summary": "Fill a cart from a small catalog, change quantities, enter a discount code and check out with a receipt: the subtotal, the one discount taken (the largest that applies - discounts never stack), the tax and the total - from a text menu.", "modules": 5, "sessions": 2, "path": "/eml-p/projects/P011-shopping-cart/" }, { "id": "P012", "slug": "library-loans", "key": "P012-library-loans", "title": "Library loans", "summary": "Lend books to members and take them back: due dates on a real calendar (leap years included), at most three books each, fines for late returns that must be paid before borrowing again, and new members - from a text menu, with the date moved forward by hand.", "modules": 4, "sessions": 2, "path": "/eml-p/projects/P012-library-loans/" }, { "id": "P013", "slug": "bill-splitter", "key": "P013-bill-splitter", "title": "Bill splitter", "summary": "Share expenses among up to eight people - each paid by one, shared equally or in shares, split to the cent by largest remainder - see who owes whom, and settle up in the fewest transfers possible, found exactly by trying every group - from a text menu.", "modules": 4, "sessions": 3, "path": "/eml-p/projects/P013-bill-splitter/" }, { "id": "P014", "slug": "loan-calculator", "key": "P014-loan-calculator", "title": "Loan calculator", "summary": "The monthly payment of a loan, worked out exactly in whole numbers and rounded by a stated rule (to the nearest cent or up to the next), the repayment schedule by year and by month, the last payment that clears the balance to exactly 0.00, and the total paid and total interest - from a text menu.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P014-loan-calculator/" }, { "id": "P015", "slug": "date-calculator", "key": "P015-date-calculator", "title": "Date calculator", "summary": "Days between two dates, the day of the week, a date plus or minus some days, whether a year is a leap year and why, and someone's age on a date - including the two rules for a 29 February birthday - on the Gregorian calendar from 1583 to 9999, from a text menu.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P015-date-calculator/" }, { "id": "P016", "slug": "text-statistics", "key": "P016-text-statistics", "title": "Text statistics", "summary": "Type several lines of text and see its counts (lines, words, letters, average and longest word), its most common words, a chart of its letters, the palindromes in it - words and whole lines - and the groups of words that are anagrams of each other, from a text menu.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P016-text-statistics/" }, { "id": "P017", "slug": "flashcards", "key": "P017-flashcards", "title": "Flashcards", "summary": "Practise decks of flashcards with Leitner boxes: a card answered right the first time moves up a box, a wrong one goes back to box 1 and comes again at the end of the practice; box k is due every 2^(k-1) practices. Two decks to start, new decks and cards, and a progress chart per deck - from a text menu.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P017-flashcards/" }, { "id": "P018", "slug": "parking-lot", "key": "P018-parking-lot", "title": "Parking lot", "summary": "Run an eight-space parking lot: cars come in and go out at typed times, each exit gets a ticket that shows how its fee was worked out - free up to 10 minutes, 3.00 for the first hour, 1.00 for each half hour after, at most 15.00 per 24 hours - and each day has a report of its takings, from a text menu.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P018-parking-lot/" }, { "id": "P019", "slug": "poll", "key": "P019-poll", "title": "Poll", "summary": "Set up a poll with two to six options, enter ranked ballots (one at a time or many identical ones at once), and count them four ways side by side - plurality, instant runoff round by round, Borda, and head to head - to see when the methods disagree, from a text menu.", "modules": 3, "sessions": 3, "path": "/eml-p/projects/P019-poll/" }, { "id": "P020", "slug": "text-adventure", "key": "P020-text-adventure", "title": "Text adventure", "summary": "Explore an old house of eight rooms on a grid - go, take, drop and use things, light a lamp for the dark cellar, unlock a door with the key found there - and carry the crown out to the garden to win; a map shows the rooms you know, and a path command finds a route through them by backtracking.", "modules": 4, "sessions": 2, "path": "/eml-p/projects/P020-text-adventure/" }, { "id": "P021", "slug": "base-converter", "key": "P021-base-converter", "title": "Base converter", "summary": "Convert whole numbers of any length between bases 2 to 36 by long division on their digits, show a number in bases 2, 8, 10 and 16 at once, and turn numbers into Roman numerals and back - refusing a numeral that is not written the standard way and saying how it should be - from a text menu.", "modules": 4, "sessions": 2, "path": "/eml-p/projects/P021-base-converter/" }, { "id": "P022", "slug": "cipher-workbench", "key": "P022-cipher-workbench", "title": "Cipher workbench", "summary": "Encode and decode with the Caesar and Vigenere ciphers - case and punctuation kept, the Vigenere key moving only on letters - and break a Caesar cipher by comparing letter counts with English for every shift; a toy for classical ciphers, not security software, from a text menu.", "modules": 4, "sessions": 2, "path": "/eml-p/projects/P022-cipher-workbench/" }, { "id": "P023", "slug": "number-toolkit", "key": "P023-number-toolkit", "title": "Number toolkit", "summary": "Whole-number tools from a text menu: is a number prime (and if not, its smallest factor), its prime factors with powers, the gcd and lcm of several numbers with Euclid's steps for two, the primes in a range by a sieve, a number's divisors - perfect, abundant or deficient - and the perfect numbers up to a limit.", "modules": 4, "sessions": 2, "path": "/eml-p/projects/P023-number-toolkit/" }, { "id": "P024", "slug": "bracket-checker", "key": "P024-bracket-checker", "title": "Bracket checker", "summary": "Checks the round, square and curly brackets of a typed text of up to 20 lines: the first error with its line, column and reason - a bracket that closes nothing, one of the wrong kind, or one never closed - the deepest nesting, and an outline of the text broken at its brackets.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P024-bracket-checker/" }, { "id": "P025", "slug": "run-length-compressor", "key": "P025-run-length-compressor", "title": "Run-length compressor", "summary": "Compresses a line of text by writing each long run of one character as ~count~character - only where that is shorter - with ~~ for a ~ in the text, so digits need no escaping; expands it back with the position and reason of any error, gives the compression ratio, and checks that every compressed text expands to the original.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P025-run-length-compressor/" }, { "id": "P026", "slug": "temperature-log", "key": "P026-temperature-log", "title": "Temperature log", "summary": "A day's temperature readings from up to six places: each place's lowest, highest and average, a moving average over 2 to 10 readings, and alerts for readings outside a place's safe range - when a reading comes in and in a list. Temperatures are kept in whole tenths of a degree, so the averages are exact until the display rounds them.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P026-temperature-log/" }, { "id": "P027", "slug": "csv-viewer", "key": "P027-csv-viewer", "title": "CSV viewer", "summary": "Paste a CSV of up to 30 rows and 8 columns - quoted fields with commas and doubled quotes included - and see it as a table; sort it by a column (numbers or text, stable, empty fields last), filter it by a condition, and get a column's statistics, with numbers kept exact.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P027-csv-viewer/" }, { "id": "P028", "slug": "spelling-suggester", "key": "P028-spelling-suggester", "title": "Spelling suggester", "summary": "Checks a line of text against a list of 352 common English words and suggests, for each word it does not know, the closest words by edit distance - insertions, deletions, substitutions and swaps of two neighbouring letters - the more common word first on a tie; suggests for a single word, and adds new words for the session.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P028-spelling-suggester/" }, { "id": "P029", "slug": "line-editor", "key": "P029-line-editor", "title": "Line editor", "summary": "A text of up to 30 lines edited with short commands - append, insert, replace, delete a line or a range, list, find - with undo and redo on two stacks. Every edit is one splice, and undoing it is the same splice reversed, so the stacks hold changes rather than copies of the text.", "modules": 2, "sessions": 2, "path": "/eml-p/projects/P029-line-editor/" }, { "id": "P030", "slug": "room-booking", "key": "P030-room-booking", "title": "Room booking", "summary": "Books three meeting rooms of 4, 8 and 12 seats over a working week. A booking that overlaps another in the same room is refused, naming the booking it clashes with and the rooms that are free instead - back-to-back bookings do not clash; each day has a schedule, free rooms can be looked up, and bookings can be cancelled.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P030-room-booking/" }, { "id": "P031", "slug": "shift-roster", "key": "P031-shift-roster", "title": "Shift roster", "summary": "A week of morning, evening and night shifts for up to 8 people with days off: assign by hand - refused with every rule it would break - or fill automatically, fairest first; a separate audit rechecks the finished roster from scratch against one shift a day, 11 hours of rest, at most 5 shifts a week and no shift on a day off.", "modules": 2, "sessions": 2, "path": "/eml-p/projects/P031-shift-roster/" }, { "id": "P032", "slug": "vending-machine", "key": "P032-vending-machine", "title": "Vending machine", "summary": "Six products with stock and prices; coins of 5 to 200 cents go in, and change comes out with the fewest coins the machine actually holds - found by dynamic programming over a limited coin box, where taking the biggest coin first can fail. If it cannot make the change the sale is refused and the coins come back. Staff restock products and refill the coin box.", "modules": 2, "sessions": 2, "path": "/eml-p/projects/P032-vending-machine/" }, { "id": "P033", "slug": "elevator", "key": "P033-elevator", "title": "Elevator", "summary": "One lift over floors 0 to 9: people call it from a floor to go to another, time moves on in steps, and the lift keeps its direction while there is a reason to go on and turns round when there is none. Statistics show how long people waited, and the same calls can be run again by a lift that takes one passenger at a time, to compare.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P033-elevator/" }, { "id": "P034", "slug": "tournament-bracket", "key": "P034-tournament-bracket", "title": "Tournament bracket", "summary": "A single-elimination bracket for 2 to 16 players typed in seed order: the top seeds get the byes, seeds are placed so that the strongest meet as late as possible, results are typed match by match and winners go through round by round to a champion. A result can be corrected while the winner's next match is still to be played.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P034-tournament-bracket/" }, { "id": "P035", "slug": "pig-dice-game", "key": "P035-pig-dice-game", "title": "Pig (dice game)", "summary": "The dice game Pig for two players or against the computer: roll as often as you like, every roll adds to the turn, a 1 loses the whole turn, and holding banks it - first to the target wins. The computer holds at 20; the dice come from a random generator written in EML, so a seed always gives the same game, and a tally shows how often each face came up.", "modules": 4, "sessions": 2, "path": "/eml-p/projects/P035-pig-dice-game/" }, { "id": "P036", "slug": "game-of-life", "key": "P036-game-of-life", "title": "Game of Life", "summary": "Conway's Game of Life on a 12 x 20 board: edit cells or pick a ready-made pattern, then run a generation at a time or many at once. Every board is remembered with the generation it first appeared in, so the program says when the board has died, stopped changing, or started to repeat - and with what period.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P036-game-of-life/" }, { "id": "P037", "slug": "pixel-paint", "key": "P037-pixel-paint", "title": "Pixel paint", "summary": "A 12 x 24 canvas of characters: paint single cells, Bresenham lines and boxes with the pen's color, fill an area with the paint bucket, switch pens (one of them erases), and undo as far back as you like. The canvas is a dictionary keyed by (row, column) tuples.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P037-pixel-paint/" }, { "id": "P038", "slug": "matrix-calculator", "key": "P038-matrix-calculator", "title": "Matrix calculator", "summary": "Up to three matrices of at most 5 x 5, typed with whole numbers, fractions or decimals and kept as exact fractions: sum, difference, product, a number times a matrix, transpose, the determinant by Gaussian elimination and the inverse by Gauss-Jordan elimination - checked by multiplying back. Each result is kept as R for the next operation.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P038-matrix-calculator/" }, { "id": "P039", "slug": "task-planner", "key": "P039-task-planner", "title": "Task planner", "summary": "Tasks with a length in days and the tasks each one needs first: an order that respects every dependency (Kahn's algorithm), each task's earliest start, finish and slack, a small chart, and the critical path that decides the total. A dependency that closes a cycle is named at once, and no plan is made until the cycle is broken.", "modules": 2, "sessions": 2, "path": "/eml-p/projects/P039-task-planner/" }, { "id": "P040", "slug": "sudoku-helper", "key": "P040-sudoku-helper", "title": "Sudoku helper", "summary": "A 4 x 4 or 9 x 9 sudoku, built in or typed in: put numbers in and take them out with a warning the moment one clashes, check the board (including when it can no longer be completed), ask for a hint that names one sure step, or let a backtracking solver finish it and say whether the solution is the only one.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P040-sudoku-helper/" }, { "id": "P041", "slug": "maze", "key": "P041-maze", "title": "Maze", "summary": "A random maze from a seed - the same seed always makes the same maze - built by a random depth-first walk with a few extra walls knocked down so that there is more than one way. Walk it from S to G, or show a shortest way found by breadth-first search beside the way the corpus case's backtracking finds.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P041-maze/" }, { "id": "P042", "slug": "tower-of-hanoi", "key": "P042-tower-of-hanoi", "title": "Tower of Hanoi", "summary": "Move a tower of 1 to 8 disks from peg A to peg C, one disk at a time, never a larger disk on a smaller one. Every move is checked; a hint names the best next move, and the program can finish from any position in the fewest moves left - 2^n - 1 from the start.", "modules": 2, "sessions": 2, "path": "/eml-p/projects/P042-tower-of-hanoi/" }, { "id": "P043", "slug": "line-diff", "key": "P043-line-diff", "title": "Line diff", "summary": "Two texts compared line by line: the longest run of lines they share, in order, stays, and everything else is shown as removed from the first or added in the second - in full with line numbers on both sides, or only the changes with a line of context around each. The texts can be swapped to see the change the other way.", "modules": 2, "sessions": 2, "path": "/eml-p/projects/P043-line-diff/" }, { "id": "P044", "slug": "statistics", "key": "P044-statistics", "title": "Statistics", "summary": "A list of numbers - whole numbers, decimals or fractions, kept exact - and what describes it: count, range, mean, median, modes, quartiles and outliers, variance and standard deviation dividing by n and by n - 1, whether the mean sits above or below the median, and a histogram whose top edge does not drop the largest value.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P044-statistics/" }, { "id": "P045", "slug": "sorting-visualizer", "key": "P045-sorting-visualizer", "title": "Sorting visualizer", "summary": "A list of up to 12 numbers sorted step by step by bubble sort, insertion sort, merge sort or counting sort - every pass, insertion or merge shown with the part already in place - with the comparisons and moves each one took, or all four side by side on the same list.", "modules": 2, "sessions": 2, "path": "/eml-p/projects/P045-sorting-visualizer/" }, { "id": "P046", "slug": "text-formatter", "key": "P046-text-formatter", "title": "Text formatter", "summary": "A paragraph set at a width from 20 to 60: left, right, centred or justified, wrapped greedily as a terminal does, or balanced by dynamic programming so that the right edge is as even as it can be - with the raggedness of both wrappings shown side by side.", "modules": 2, "sessions": 2, "path": "/eml-p/projects/P046-text-formatter/" }, { "id": "P047", "slug": "minesweeper", "key": "P047-minesweeper", "title": "Minesweeper", "summary": "Open every cell without a mine on a field of up to 12 x 16: numbers count the mines around a cell, cells with none around open their neighbours by themselves, and flags mark the mines you are sure of. The mines are laid after the first move - never on that cell or next to it - from a seed, so the same seed lays the same field.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P047-minesweeper/" }, { "id": "P048", "slug": "2048", "key": "P048-2048", "title": "2048", "summary": "Slide the tiles of a 4 x 4 board - or 3 x 3 to 6 x 6 - up, down, left or right: two equal tiles that meet join into one with their sum, each tile once a move, and every move that changes the board brings a new 2 or 4. Reach the goal tile and keep going until no move is left; the same seed brings the same tiles.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P048-2048/" }, { "id": "P049", "slug": "blackjack", "key": "P049-blackjack", "title": "Blackjack", "summary": "Blackjack against the dealer with one deck and a stack of chips: hit, stand or double, aces counted 1 or 11 with soft totals shown, the dealer drawing to 16 and standing on every 17, a blackjack paying 3 to 2. The deck is shuffled by a Fisher-Yates shuffle on EML's own random numbers, so a seed deals the same cards every time.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P049-blackjack/" }, { "id": "P050", "slug": "connect-four", "key": "P050-connect-four", "title": "Connect Four", "summary": "Drop discs into a grid of 7 columns and 6 rows and be the first with four in a row - across, down or diagonally. Play a friend, or the computer, going first or second: it wins when it can, blocks when it must, and looks one move ahead so as not to set up your win. A running score is kept.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P050-connect-four/" }, { "id": "P051", "slug": "hangman", "key": "P051-hangman", "title": "Hangman", "summary": "Guess a secret word from a list of over a hundred, a letter at a time or the whole word at once, before six wrong guesses finish the drawing. A hint counts, among the words that still fit what you know, how many hold each letter you have not tried. Words come from a seed, none twice until the list is used up.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P051-hangman/" }, { "id": "P052", "slug": "bst-explorer", "key": "P052-bst-explorer", "title": "Binary search tree explorer", "summary": "A binary search tree of whole numbers: insert keys, delete them - a leaf, a node with one child, or one with two, replaced by its successor - and search with the path shown. Walk it in order, pre-order and post-order, see its size, height, smallest and largest key, and see it drawn on its side.", "modules": 2, "sessions": 2, "path": "/eml-p/projects/P052-bst-explorer/" }, { "id": "P053", "slug": "help-desk", "key": "P053-help-desk", "title": "Help desk queue", "summary": "Support tickets with four priorities, served most urgent first and first come, first served within a priority, kept in a binary heap. Open, serve, list the line, change a waiting ticket's priority or cancel it, and see the queue grouped by priority next to what has been served.", "modules": 2, "sessions": 2, "path": "/eml-p/projects/P053-help-desk/" }, { "id": "P054", "slug": "sliding-puzzle", "key": "P054-sliding-puzzle", "title": "Sliding puzzle", "summary": "The 3 x 3 and 4 x 4 sliding puzzles: shuffled boards that are always solvable, typed boards checked by counting the pairs out of order, several tiles slid in one line, and for 3 x 3 the fewest moves found by breadth-first search from both ends.", "modules": 4, "sessions": 2, "path": "/eml-p/projects/P054-sliding-puzzle/" }, { "id": "P055", "slug": "habit-tracker", "key": "P055-habit-tracker", "title": "Habit tracker", "summary": "Up to five habits checked in on real calendar days: the streak still running, the longest streak, check-ins taken back, and any month drawn as a Monday-first calendar with the days done - dates counted from 1900 and weekdays by Zeller's congruence.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P055-habit-tracker/" }, { "id": "P056", "slug": "mini-spreadsheet", "key": "P056-mini-spreadsheet", "title": "Mini spreadsheet", "summary": "Cells A1 to F9 holding numbers, labels and formulas - + - * / with parentheses, cell references, SUM, MIN, MAX and AVG over ranges - kept as exact fractions. Every change recalculates the sheet in dependency order (Kahn's algorithm), and formulas caught in a cycle are found and marked instead of looping.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P056-mini-spreadsheet/" }, { "id": "P057", "slug": "scales-and-chords", "key": "P057-scales-and-chords", "title": "Scales and chords", "summary": "Major and minor scales and nine kinds of chords from any root, spelled on the right letters (F major has Bb, not A#), intervals named from their letters and semitones with their simple frequency ratio and where the two notes' overtones meet, and chord progressions moved to another key.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P057-scales-and-chords/" }, { "id": "P058", "slug": "round-robin", "key": "P058-round-robin", "title": "Teams and round robin", "summary": "Split up to 16 rated players into two teams as even as possible - a backtracking search that drops any branch past half - or into three or four by a quick rule; then a league where everyone meets everyone once, scheduled by the circle method, with results entered as they come and a table sorted by points, goal difference and goals.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P058-round-robin/" }, { "id": "P059", "slug": "workout-log", "key": "P059-workout-log", "title": "Workout log", "summary": "Exercises logged as sets x reps at a weight on real dates, kept exact in tenths of a kilogram: the history day by day, each exercise's heaviest weight and best estimated one-rep max (Epley), and the volume lifted week by week, Monday to Sunday, drawn as a chart that adds back up to the total.", "modules": 3, "sessions": 2, "path": "/eml-p/projects/P059-workout-log/" }, { "id": "P060", "slug": "probability-lab", "key": "P060-probability-lab", "title": "Probability lab", "summary": "The birthday problem, the Monty Hall game with a host who knows and a host who guesses, and the sum of two dice - each worked out exactly as a fraction and then tried thousands of times on EML's own random numbers, side by side.", "modules": 4, "sessions": 2, "path": "/eml-p/projects/P060-probability-lab/" } ] }